Incidental Mutation 'R0433:Uggt2'
ID38962
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene NameUDP-glucose glycoprotein glucosyltransferase 2
Synonyms3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik
MMRRC Submission 038635-MU
Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R0433 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location118985039-119099430 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 119075329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156203]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136924
Predicted Effect probably null
Transcript: ENSMUST00000156203
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 99% (108/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,303 V199A possibly damaging Het
2410089E03Rik T C 15: 8,216,562 S1473P probably benign Het
Abcb5 T C 12: 118,877,810 M967V probably benign Het
Adcy10 T A 1: 165,552,022 L951Q probably damaging Het
Amer2 A T 14: 60,378,583 S76C probably damaging Het
Atad1 T C 19: 32,698,477 I182M probably benign Het
Bpi A G 2: 158,258,419 D42G probably damaging Het
C7 G T 15: 4,988,916 T815K probably damaging Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Camk1g A G 1: 193,354,058 F165L probably damaging Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccser2 A C 14: 36,918,529 F37L probably damaging Het
Cfap43 A G 19: 47,825,771 F208S probably benign Het
Cfap54 G A 10: 92,979,080 probably benign Het
Cfap69 A C 5: 5,649,853 D62E probably damaging Het
Cnksr2 C A X: 157,888,557 M483I probably benign Het
Cnksr2 A T X: 157,888,558 M483K probably benign Het
Cog8 T C 8: 107,056,478 S60G possibly damaging Het
Col4a3 C T 1: 82,670,219 P484S unknown Het
Col6a4 C T 9: 106,067,994 G974R probably damaging Het
Dbnl T G 11: 5,796,825 probably null Het
Dhcr7 T C 7: 143,840,463 C114R possibly damaging Het
Dnah2 C A 11: 69,459,288 D2340Y probably damaging Het
Dusp10 T A 1: 184,069,196 Y387N probably damaging Het
Eipr1 C T 12: 28,859,331 T199I possibly damaging Het
Emc2 T G 15: 43,497,124 probably null Het
Enpp3 A G 10: 24,820,597 S147P probably benign Het
Fam133b T A 5: 3,558,560 probably benign Het
Fam205c A G 4: 42,874,013 probably benign Het
Fat1 C A 8: 45,024,649 T2244K possibly damaging Het
Fbn1 A G 2: 125,348,215 S1453P possibly damaging Het
Fez2 A T 17: 78,418,047 F13I probably damaging Het
Ggnbp2 T C 11: 84,836,420 K530R probably damaging Het
Gm597 A T 1: 28,777,342 Y536* probably null Het
Gpa33 T C 1: 166,163,761 probably benign Het
Gpr142 T C 11: 114,805,997 I123T probably damaging Het
Il21 T G 3: 37,232,535 I11L possibly damaging Het
Klhl7 A G 5: 24,127,702 E86G probably damaging Het
Klk10 G T 7: 43,781,565 A11S possibly damaging Het
Knl1 A T 2: 119,104,061 D2115V probably damaging Het
Lonp2 A G 8: 86,633,954 D185G probably damaging Het
Lrrc47 T C 4: 154,018,365 probably benign Het
Lrrcc1 A G 3: 14,559,374 I698V probably damaging Het
Lzts2 T C 19: 45,021,676 V83A possibly damaging Het
Melk C A 4: 44,340,614 probably benign Het
Mical1 G A 10: 41,479,490 V150I probably benign Het
Morn3 C A 5: 123,039,333 M129I probably benign Het
Mroh2b T A 15: 4,941,634 D1040E probably benign Het
Mroh5 T C 15: 73,790,028 N438S probably benign Het
Mroh5 T A 15: 73,790,808 Q387L probably damaging Het
Myh15 A G 16: 49,145,236 D1168G probably damaging Het
Nek10 A G 14: 14,860,927 E493G probably benign Het
Nipsnap3a A G 4: 53,000,316 Y227C probably damaging Het
Nlrp9c T A 7: 26,385,819 T112S probably benign Het
Nphp4 T C 4: 152,518,172 V401A probably benign Het
Nr1h2 A G 7: 44,549,987 *365Q probably null Het
Olfr1339 T C 4: 118,735,090 V187A probably benign Het
Olfr474 T C 7: 107,955,262 I207T probably damaging Het
Pacs2 T A 12: 113,056,844 V279D possibly damaging Het
Pdcd2 C T 17: 15,526,384 C171Y probably benign Het
Pde11a T A 2: 76,337,706 D301V possibly damaging Het
Pfpl T G 19: 12,429,475 N363K probably damaging Het
Phf14 T A 6: 11,933,743 S201R probably damaging Het
Pip4k2c G A 10: 127,208,946 P66S probably benign Het
Pou2f3 G T 9: 43,127,398 H392N probably benign Het
Pou3f1 G T 4: 124,658,904 G400C probably damaging Het
Ptprg T C 14: 12,220,620 I1219T probably damaging Het
Rfx6 A G 10: 51,720,028 D435G probably damaging Het
Rhpn2 T A 7: 35,385,474 S598T probably benign Het
Sdccag8 C A 1: 176,844,821 probably null Het
Sec16b C A 1: 157,534,709 Y43* probably null Het
Sele T C 1: 164,049,244 Y30H possibly damaging Het
Sgsm2 C T 11: 74,858,190 probably null Het
Slc45a2 T C 15: 11,025,745 Y394H probably benign Het
Slc4a10 T G 2: 62,289,983 I788S probably benign Het
Slmap A T 14: 26,453,594 L161* probably null Het
Slx4 A T 16: 3,986,018 D977E probably benign Het
Spen A T 4: 141,483,758 M608K unknown Het
St8sia4 G C 1: 95,591,704 T353R probably damaging Het
Stab2 G T 10: 86,843,491 probably benign Het
Stx12 C T 4: 132,858,430 G213D probably damaging Het
Synj2 A T 17: 6,033,848 N270Y probably damaging Het
Tdrd9 C T 12: 112,025,581 R438* probably null Het
Tert T C 13: 73,627,081 Y18H probably damaging Het
Tph1 A T 7: 46,653,821 F244L probably damaging Het
Triobp T C 15: 78,968,201 F852L possibly damaging Het
Trpv1 T C 11: 73,253,008 probably benign Het
Ulk4 A G 9: 121,044,819 I1182T probably benign Het
Uqcc1 A G 2: 155,910,368 Y98H probably damaging Het
Usp25 A G 16: 77,109,217 I854V probably benign Het
Usp50 T C 2: 126,761,544 S361G probably damaging Het
Uspl1 C A 5: 149,214,815 Q743K probably damaging Het
Vmn2r3 A G 3: 64,275,633 V215A possibly damaging Het
Vmn2r61 A T 7: 42,265,911 H94L probably benign Het
Vps37c T C 19: 10,713,029 V285A probably benign Het
Vwa8 T C 14: 79,062,676 V983A probably damaging Het
Wdr78 T C 4: 103,103,253 N67D probably benign Het
Zcchc9 C T 13: 91,805,962 R58H probably benign Het
Zdbf2 T C 1: 63,306,143 V1227A possibly damaging Het
Zfp292 T C 4: 34,839,959 K64E probably damaging Het
Zfp948 A G 17: 21,587,502 T319A probably benign Het
Zp3r T G 1: 130,577,133 probably benign Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119049276 missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119026429 nonsense probably null
IGL00433:Uggt2 APN 14 119013487 missense probably benign
IGL00572:Uggt2 APN 14 119042791 missense probably benign 0.02
IGL00577:Uggt2 APN 14 119034900 missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119042799 missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119057645 missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119042772 missense probably benign 0.00
IGL01787:Uggt2 APN 14 119081734 missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119089193 missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119090738 missense probably benign 0.17
IGL02894:Uggt2 APN 14 119081799 missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119075346 missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119095310 missense probably benign 0.25
IGL03142:Uggt2 APN 14 118998191 missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119077668 missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119070888 missense probably benign 0.38
P0014:Uggt2 UTSW 14 119044538 missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119049663 missense probably benign 0.07
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0383:Uggt2 UTSW 14 119049451 missense probably damaging 1.00
R0472:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119057598 missense probably benign 0.27
R0788:Uggt2 UTSW 14 119095400 splice site probably benign
R0940:Uggt2 UTSW 14 119091192 critical splice donor site probably null
R1567:Uggt2 UTSW 14 119009093 missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119057663 missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119054643 missense probably benign 0.19
R1746:Uggt2 UTSW 14 119013503 missense probably benign 0.00
R1785:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119032276 missense probably benign 0.00
R1894:Uggt2 UTSW 14 119049718 missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119008055 splice site probably benign
R2149:Uggt2 UTSW 14 119075345 missense probably benign 0.02
R2168:Uggt2 UTSW 14 119019505 missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2240:Uggt2 UTSW 14 118995049 missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119026599 missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119059109 missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2907:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2908:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2998:Uggt2 UTSW 14 119049385 missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119091270 missense probably benign 0.39
R3722:Uggt2 UTSW 14 119041518 missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119057672 missense probably benign 0.13
R4015:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119049262 missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119019558 missense probably benign
R4642:Uggt2 UTSW 14 119034935 missense probably benign 0.00
R4654:Uggt2 UTSW 14 119032258 missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119029054 splice site probably null
R4810:Uggt2 UTSW 14 119013521 missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119001847 missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119035964 splice site probably null
R4886:Uggt2 UTSW 14 119035964 splice site probably null
R4888:Uggt2 UTSW 14 119049253 missense probably damaging 1.00
R4888:Uggt2 UTSW 14 119077650 critical splice donor site probably null
R4895:Uggt2 UTSW 14 119018886 missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119081770 missense probably benign 0.00
R5423:Uggt2 UTSW 14 119019486 missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119090709 missense probably benign 0.01
R5561:Uggt2 UTSW 14 119041527 missense probably benign 0.02
R5607:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119077724 missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119042726 missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119049426 missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6056:Uggt2 UTSW 14 119035969 critical splice donor site probably null
R6289:Uggt2 UTSW 14 119041602 missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119057564 missense probably benign 0.01
R6515:Uggt2 UTSW 14 119077719 missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119070881 missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119042610 missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119026435 missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119001859 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACCCGACTTCATGTTCTTTCCAAAACC -3'
(R):5'- GTGTTCCATTGCATACGTGATTGTTCCT -3'

Sequencing Primer
(F):5'- aaaggaaggaaggaaggaaggaag -3'
(R):5'- GCATACGTGATTGTTCCTAAGCAC -3'
Posted On2013-05-23