Incidental Mutation 'R4998:Rap1gap'
ID389627
Institutional Source Beutler Lab
Gene Symbol Rap1gap
Ensembl Gene ENSMUSG00000041351
Gene NameRap1 GTPase-activating protein
Synonyms1300019I11Rik, 2310004O14Rik, Rap1ga1
MMRRC Submission 042592-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4998 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137664726-137729861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137728284 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 381 (D381G)
Ref Sequence ENSEMBL: ENSMUSP00000122315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047243] [ENSMUST00000097837] [ENSMUST00000105835] [ENSMUST00000141306]
Predicted Effect probably benign
Transcript: ENSMUST00000047243
AA Change: D699G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000042473
Gene: ENSMUSG00000041351
AA Change: D699G

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 461 1.4e-64 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097837
AA Change: D666G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095448
Gene: ENSMUSG00000041351
AA Change: D666G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
GoLoco 26 48 4.94e-10 SMART
Pfam:Rap_GAP 241 428 1.2e-64 PFAM
low complexity region 452 462 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
low complexity region 647 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105835
AA Change: T692A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101461
Gene: ENSMUSG00000041351
AA Change: T692A

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 455 4.5e-66 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123134
Predicted Effect possibly damaging
Transcript: ENSMUST00000141306
AA Change: D381G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122315
Gene: ENSMUSG00000041351
AA Change: D381G

DomainStartEndE-ValueType
Pfam:Rap_GAP 1 117 1.4e-32 PFAM
low complexity region 141 151 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151601
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type of GTPase-activating-protein (GAP) that down-regulates the activity of the ras-related RAP1 protein. RAP1 acts as a molecular switch by cycling between an inactive GDP-bound form and an active GTP-bound form. The product of this gene, RAP1GAP, promotes the hydrolysis of bound GTP and hence returns RAP1 to the inactive state whereas other proteins, guanine nucleotide exchange factors (GEFs), act as RAP1 activators by facilitating the conversion of RAP1 from the GDP- to the GTP-bound form. In general, ras subfamily proteins, such as RAP1, play key roles in receptor-linked signaling pathways that control cell growth and differentiation. RAP1 plays a role in diverse processes such as cell proliferation, adhesion, differentiation, and embryogenesis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enox1 A T 14: 77,501,435 probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Espn A T 4: 152,135,583 M361K possibly damaging Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Kif27 A G 13: 58,293,143 S1153P probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Mmel1 A G 4: 154,885,510 K177R probably benign Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Npepps A G 11: 97,206,107 probably benign Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pdpr G T 8: 111,114,768 V211F probably damaging Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Ramp2 T A 11: 101,247,421 probably benign Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem132a G T 19: 10,858,941 P742T probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Rap1gap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Rap1gap APN 4 137716524 missense probably damaging 0.98
IGL01810:Rap1gap APN 4 137716155 missense probably benign 0.07
IGL01944:Rap1gap APN 4 137725620 missense probably damaging 1.00
IGL02117:Rap1gap APN 4 137727044 missense probably damaging 0.98
IGL02271:Rap1gap APN 4 137718006 missense probably damaging 1.00
IGL02272:Rap1gap APN 4 137716566 missense probably damaging 1.00
IGL02590:Rap1gap APN 4 137720300 missense probably damaging 0.98
IGL02626:Rap1gap APN 4 137727053 missense probably benign 0.00
IGL03211:Rap1gap APN 4 137715846 critical splice donor site probably null
R0243:Rap1gap UTSW 4 137719351 missense probably damaging 0.99
R1239:Rap1gap UTSW 4 137717996 missense probably damaging 1.00
R1246:Rap1gap UTSW 4 137712094 missense possibly damaging 0.86
R2264:Rap1gap UTSW 4 137727723 missense probably benign
R2935:Rap1gap UTSW 4 137724731 missense probably benign 0.19
R3840:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R3841:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R4619:Rap1gap UTSW 4 137716111 missense probably damaging 1.00
R4821:Rap1gap UTSW 4 137712129 missense probably damaging 0.99
R5061:Rap1gap UTSW 4 137720433 critical splice donor site probably null
R5800:Rap1gap UTSW 4 137720377 missense probably benign 0.00
R6259:Rap1gap UTSW 4 137681757 critical splice donor site probably null
R7082:Rap1gap UTSW 4 137718936 missense probably damaging 1.00
R7098:Rap1gap UTSW 4 137716082 splice site probably null
R7234:Rap1gap UTSW 4 137728540 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGACAGCCTCTTACGTG -3'
(R):5'- AGAAGTCACTGGAAGAGCCC -3'

Sequencing Primer
(F):5'- CTTACGTGGGGCGGTGATCC -3'
(R):5'- TGGAAGAGCCCAGTCCTTCTG -3'
Posted On2016-06-06