Incidental Mutation 'R4998:Espn'
ID389628
Institutional Source Beutler Lab
Gene Symbol Espn
Ensembl Gene ENSMUSG00000028943
Gene Nameespin
Synonyms
MMRRC Submission 042592-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R4998 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152120331-152152371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 152135583 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 361 (M361K)
Ref Sequence ENSEMBL: ENSMUSP00000147144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030785] [ENSMUST00000070018] [ENSMUST00000080042] [ENSMUST00000084114] [ENSMUST00000103196] [ENSMUST00000105653] [ENSMUST00000105654] [ENSMUST00000105655] [ENSMUST00000105656] [ENSMUST00000105657] [ENSMUST00000105658] [ENSMUST00000105659] [ENSMUST00000135185] [ENSMUST00000207676]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030785
AA Change: M361K

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030785
Gene: ENSMUSG00000028943
AA Change: M361K

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 605 629 N/A INTRINSIC
WH2 669 686 4.82e-3 SMART
low complexity region 714 728 N/A INTRINSIC
low complexity region 740 748 N/A INTRINSIC
coiled coil region 772 848 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070018
AA Change: M34K

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065545
Gene: ENSMUSG00000028943
AA Change: M34K

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
WH2 322 339 4.82e-3 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 393 401 N/A INTRINSIC
SCOP:d1eq1a_ 432 499 4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080042
AA Change: M34K

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078951
Gene: ENSMUSG00000028943
AA Change: M34K

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
WH2 250 267 4.82e-3 SMART
low complexity region 295 309 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
SCOP:d1eq1a_ 360 427 2e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084114
AA Change: M34K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081131
Gene: ENSMUSG00000028943
AA Change: M34K

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
WH2 331 348 4.82e-3 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 402 410 N/A INTRINSIC
SCOP:d1eq1a_ 441 508 6e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103196
AA Change: M34K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099485
Gene: ENSMUSG00000028943
AA Change: M34K

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
low complexity region 220 229 N/A INTRINSIC
WH2 238 255 4.82e-3 SMART
low complexity region 283 297 N/A INTRINSIC
low complexity region 309 317 N/A INTRINSIC
SCOP:d1eq1a_ 348 415 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105653
SMART Domains Protein: ENSMUSP00000101278
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 28 52 N/A INTRINSIC
low complexity region 65 74 N/A INTRINSIC
WH2 83 100 4.82e-3 SMART
low complexity region 128 142 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
coiled coil region 186 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105654
AA Change: M34K

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101279
Gene: ENSMUSG00000028943
AA Change: M34K

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
low complexity region 301 310 N/A INTRINSIC
WH2 319 336 4.82e-3 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 390 398 N/A INTRINSIC
SCOP:d1eq1a_ 429 496 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105655
AA Change: M34K

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101280
Gene: ENSMUSG00000028943
AA Change: M34K

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
WH2 247 264 4.82e-3 SMART
low complexity region 292 306 N/A INTRINSIC
low complexity region 318 326 N/A INTRINSIC
SCOP:d1eq1a_ 357 424 3e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105656
AA Change: M34K

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101281
Gene: ENSMUSG00000028943
AA Change: M34K

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
WH2 328 345 4.82e-3 SMART
low complexity region 373 387 N/A INTRINSIC
low complexity region 399 407 N/A INTRINSIC
SCOP:d1eq1a_ 438 505 8e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105657
AA Change: M34K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101282
Gene: ENSMUSG00000028943
AA Change: M34K

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
WH2 241 258 4.82e-3 SMART
low complexity region 286 300 N/A INTRINSIC
low complexity region 312 320 N/A INTRINSIC
SCOP:d1eq1a_ 351 418 2e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105658
AA Change: M361K

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101283
Gene: ENSMUSG00000028943
AA Change: M361K

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 425 462 N/A INTRINSIC
low complexity region 591 615 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
WH2 646 663 4.82e-3 SMART
low complexity region 691 705 N/A INTRINSIC
low complexity region 717 725 N/A INTRINSIC
coiled coil region 749 825 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105659
AA Change: M361K

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101284
Gene: ENSMUSG00000028943
AA Change: M361K

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 624 648 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
WH2 679 696 4.82e-3 SMART
low complexity region 724 738 N/A INTRINSIC
low complexity region 750 758 N/A INTRINSIC
coiled coil region 782 858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135185
AA Change: M263K

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122464
Gene: ENSMUSG00000028943
AA Change: M263K

DomainStartEndE-ValueType
ANK 5 35 2.58e-3 SMART
ANK 39 69 1.63e0 SMART
ANK 73 103 4.97e-5 SMART
ANK 107 137 3.08e-1 SMART
ANK 141 170 9.13e-4 SMART
ANK 173 202 2.15e0 SMART
ANK 206 236 2.08e3 SMART
low complexity region 279 297 N/A INTRINSIC
low complexity region 330 367 N/A INTRINSIC
low complexity region 496 520 N/A INTRINSIC
low complexity region 533 542 N/A INTRINSIC
WH2 551 568 4.82e-3 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 622 630 N/A INTRINSIC
coiled coil region 654 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156517
Predicted Effect possibly damaging
Transcript: ENSMUST00000207676
AA Change: M361K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional actin-bundling protein. It plays a major role in regulating the organization, dimensions, dynamics, and signaling capacities of the actin filament-rich, microvillus-type specializations that mediate sensory transduction in various mechanosensory and chemosensory cells. Mutations in this gene are associated with autosomal recessive neurosensory deafness, and autosomal dominant sensorineural deafness without vestibular involvement. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit progressive degeneration of both inner and outer hair cells, severe deafness, vestibular dysfunction, and poor mothering ability. Heterozygotes show a progressive, age-related hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enox1 A T 14: 77,501,435 probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Kif27 A G 13: 58,293,143 S1153P probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Mmel1 A G 4: 154,885,510 K177R probably benign Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Npepps A G 11: 97,206,107 probably benign Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pdpr G T 8: 111,114,768 V211F probably damaging Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Ramp2 T A 11: 101,247,421 probably benign Het
Rap1gap A G 4: 137,728,284 D381G possibly damaging Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem132a G T 19: 10,858,941 P742T probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Espn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Espn APN 4 152135602 missense probably damaging 1.00
IGL01404:Espn APN 4 152138444 missense probably benign 0.03
IGL01576:Espn APN 4 152123717 missense probably damaging 1.00
R0015:Espn UTSW 4 152139152 missense possibly damaging 0.77
R1475:Espn UTSW 4 152134271 missense probably damaging 1.00
R1773:Espn UTSW 4 152128229 missense probably damaging 1.00
R1992:Espn UTSW 4 152128555 critical splice acceptor site probably null
R2014:Espn UTSW 4 152132959 splice site probably null
R2049:Espn UTSW 4 152121257 missense probably damaging 0.99
R2281:Espn UTSW 4 152135545 missense possibly damaging 0.94
R4278:Espn UTSW 4 152134417 missense probably damaging 1.00
R4527:Espn UTSW 4 152135649 missense probably damaging 0.99
R4539:Espn UTSW 4 152134208 nonsense probably null
R4621:Espn UTSW 4 152131252 missense probably damaging 1.00
R4839:Espn UTSW 4 152138504 missense probably damaging 0.99
R4860:Espn UTSW 4 152138846 missense probably damaging 0.99
R4860:Espn UTSW 4 152138846 missense probably damaging 0.99
R5412:Espn UTSW 4 152128125 missense probably damaging 1.00
R5570:Espn UTSW 4 152123780 missense probably damaging 1.00
R6549:Espn UTSW 4 152131068 start codon destroyed probably null 0.99
R6551:Espn UTSW 4 152128766
R7124:Espn UTSW 4 152131264 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTTCAAGTGCATCCCCTC -3'
(R):5'- ATAGGAGTCTGGATAGGCCTG -3'

Sequencing Primer
(F):5'- CTCTCCATGTTAAGACATTGACTG -3'
(R):5'- GCCTGGCCTGGAAGTTATC -3'
Posted On2016-06-06