Incidental Mutation 'R4998:Mmel1'
ID389629
Institutional Source Beutler Lab
Gene Symbol Mmel1
Ensembl Gene ENSMUSG00000058183
Gene Namemembrane metallo-endopeptidase-like 1
SynonymsNep2, Mell1, Nl1, NEPLP gamma, NEPLP beta, NEPLP alpha, SEP
MMRRC Submission 042592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R4998 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154869585-154895528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154885510 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 177 (K177R)
Ref Sequence ENSEMBL: ENSMUSP00000101259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079269] [ENSMUST00000080559] [ENSMUST00000105634] [ENSMUST00000105635] [ENSMUST00000131758] [ENSMUST00000163732]
Predicted Effect probably benign
Transcript: ENSMUST00000079269
AA Change: K200R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078252
Gene: ENSMUSG00000058183
AA Change: K200R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 767 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080559
AA Change: K177R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079399
Gene: ENSMUSG00000058183
AA Change: K177R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 4.8e-131 PFAM
Pfam:Peptidase_M13 573 779 3.4e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105634
AA Change: K177R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101259
Gene: ENSMUSG00000058183
AA Change: K177R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 1.4e-105 PFAM
Pfam:Peptidase_M13 573 781 4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105635
AA Change: K177R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101260
Gene: ENSMUSG00000058183
AA Change: K177R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 475 1.6e-135 PFAM
Pfam:Peptidase_M13 536 744 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131758
AA Change: K109R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121243
Gene: ENSMUSG00000058183
AA Change: K109R

DomainStartEndE-ValueType
Pfam:Peptidase_M13_N 8 150 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163732
AA Change: K200R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131753
Gene: ENSMUSG00000058183
AA Change: K200R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 765 3.3e-71 PFAM
Meta Mutation Damage Score 0.1304 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the neutral endopeptidase (NEP) or membrane metallo-endopeptidase (MME) family. Family members play important roles in pain perception, arterial pressure regulation, phosphate metabolism and homeostasis. This protein is a type II transmembrane protein and is thought to be expressed as a secreted protein. This gene is expressed mainly in testis with weak expression in the brain, kidney, and heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired male fertility. Female fertility is not affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enox1 A T 14: 77,501,435 probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Espn A T 4: 152,135,583 M361K possibly damaging Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Kif27 A G 13: 58,293,143 S1153P probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Npepps A G 11: 97,206,107 probably benign Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pdpr G T 8: 111,114,768 V211F probably damaging Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Ramp2 T A 11: 101,247,421 probably benign Het
Rap1gap A G 4: 137,728,284 D381G possibly damaging Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem132a G T 19: 10,858,941 P742T probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Mmel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Mmel1 APN 4 154887832 splice site probably benign
IGL01560:Mmel1 APN 4 154892510 missense probably null 1.00
IGL01734:Mmel1 APN 4 154891951 missense probably benign 0.00
IGL02933:Mmel1 APN 4 154883630 missense probably damaging 1.00
IGL03178:Mmel1 APN 4 154890854 missense possibly damaging 0.75
R1161:Mmel1 UTSW 4 154895214 missense probably damaging 1.00
R1522:Mmel1 UTSW 4 154894986 missense probably damaging 1.00
R1566:Mmel1 UTSW 4 154883653 missense probably damaging 1.00
R1885:Mmel1 UTSW 4 154890876 missense possibly damaging 0.76
R2177:Mmel1 UTSW 4 154894103 missense probably damaging 1.00
R3413:Mmel1 UTSW 4 154889586 missense probably damaging 1.00
R3432:Mmel1 UTSW 4 154885498 splice site probably benign
R3870:Mmel1 UTSW 4 154883638 missense probably benign 0.01
R4197:Mmel1 UTSW 4 154893304 missense probably damaging 1.00
R4822:Mmel1 UTSW 4 154887897 missense probably benign 0.00
R5135:Mmel1 UTSW 4 154882324 missense probably benign 0.20
R5225:Mmel1 UTSW 4 154891999 missense probably damaging 0.96
R5821:Mmel1 UTSW 4 154885587 missense possibly damaging 0.82
R6131:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6132:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6133:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6194:Mmel1 UTSW 4 154883216 nonsense probably null
R6223:Mmel1 UTSW 4 154871702 unclassified probably null
R6786:Mmel1 UTSW 4 154892428 nonsense probably null
R6921:Mmel1 UTSW 4 154881677 missense probably damaging 0.97
R7272:Mmel1 UTSW 4 154894090 missense probably damaging 1.00
X0025:Mmel1 UTSW 4 154894685 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTATCTCCCTACGGAATACTTG -3'
(R):5'- AGCCATCGTCCTGGTCTATC -3'

Sequencing Primer
(F):5'- CGGAATACTTGGAGAATAGTCCCTC -3'
(R):5'- TTTGCTGCCAAAGTCCAGAG -3'
Posted On2016-06-06