Incidental Mutation 'R4998:Pdpr'
ID389646
Institutional Source Beutler Lab
Gene Symbol Pdpr
Ensembl Gene ENSMUSG00000033624
Gene Namepyruvate dehydrogenase phosphatase regulatory subunit
Synonyms4930402E16Rik
MMRRC Submission 042592-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R4998 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111094630-111137074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111114768 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 211 (V211F)
Ref Sequence ENSEMBL: ENSMUSP00000121325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039333] [ENSMUST00000135302] [ENSMUST00000144377]
Predicted Effect probably damaging
Transcript: ENSMUST00000039333
AA Change: V211F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046639
Gene: ENSMUSG00000033624
AA Change: V211F

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 235 8.3e-8 PFAM
Pfam:DAO 43 401 1.5e-58 PFAM
Pfam:FAO_M 404 459 1.2e-19 PFAM
Pfam:GCV_T 461 738 4.7e-71 PFAM
Pfam:GCV_T_C 746 854 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135302
SMART Domains Protein: ENSMUSP00000117570
Gene: ENSMUSG00000033624

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:DAO 43 145 4.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144377
AA Change: V211F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121325
Gene: ENSMUSG00000033624
AA Change: V211F

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 236 2.4e-8 PFAM
Pfam:DAO 43 401 3.3e-72 PFAM
Pfam:GCV_T 522 667 1.4e-29 PFAM
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase complex (PDC) catalyzes the oxidative decarboxylation of pyruvate and links glycolysis to the tricarboxylic acid cycle and fatty acid synthesis. The dephosphorylation and reactivation of PDC is catalyzed by pyruvate dehydrogenase phosphatase (PDP). The dimeric PDP has a catalytic subunit and a regulatory subunit. This gene encodes the FAD-containing regulatory subunit of PDP. The encoded protein acts to decrease the sensitivity of the PDP catalytic subunit to magnesium ions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enox1 A T 14: 77,501,435 probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Espn A T 4: 152,135,583 M361K possibly damaging Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Kif27 A G 13: 58,293,143 S1153P probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Mmel1 A G 4: 154,885,510 K177R probably benign Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Npepps A G 11: 97,206,107 probably benign Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Ramp2 T A 11: 101,247,421 probably benign Het
Rap1gap A G 4: 137,728,284 D381G possibly damaging Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem132a G T 19: 10,858,941 P742T probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Pdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Pdpr APN 8 111102072 missense possibly damaging 0.69
IGL01116:Pdpr APN 8 111112710 missense possibly damaging 0.84
IGL01353:Pdpr APN 8 111121278 splice site probably null
IGL01681:Pdpr APN 8 111132936 missense probably damaging 1.00
IGL01785:Pdpr APN 8 111129656 missense probably damaging 0.98
IGL02115:Pdpr APN 8 111103998 missense probably damaging 1.00
IGL02292:Pdpr APN 8 111125680 missense probably damaging 1.00
IGL02749:Pdpr APN 8 111118090 missense probably benign 0.01
IGL03296:Pdpr APN 8 111114798 missense probably damaging 1.00
R0730:Pdpr UTSW 8 111125755 critical splice donor site probably null
R1510:Pdpr UTSW 8 111124475 splice site probably benign
R1837:Pdpr UTSW 8 111134734 missense probably damaging 1.00
R1838:Pdpr UTSW 8 111134734 missense probably damaging 1.00
R2144:Pdpr UTSW 8 111118036 missense probably damaging 0.97
R4214:Pdpr UTSW 8 111129580 intron probably benign
R4812:Pdpr UTSW 8 111116717 missense probably benign 0.00
R4863:Pdpr UTSW 8 111101951 missense probably benign 0.01
R5579:Pdpr UTSW 8 111123816 missense probably damaging 1.00
R5665:Pdpr UTSW 8 111114811 missense possibly damaging 0.55
R5739:Pdpr UTSW 8 111134620 missense possibly damaging 0.78
R6675:Pdpr UTSW 8 111101900 nonsense probably null
R6785:Pdpr UTSW 8 111124611 missense probably benign 0.00
R6889:Pdpr UTSW 8 111124613 critical splice donor site probably null
R7397:Pdpr UTSW 8 111112753 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAATGCTCTTAACCAGTAAGCCTTC -3'
(R):5'- AGCTCTGGATTACCCACTCC -3'

Sequencing Primer
(F):5'- GACAGTTTCTTTATGTAGCTCTAGC -3'
(R):5'- GCTCTGGATTACCCACTCCAAATAAG -3'
Posted On2016-06-06