Incidental Mutation 'R4998:Ramp2'
ID389664
Institutional Source Beutler Lab
Gene Symbol Ramp2
Ensembl Gene ENSMUSG00000001240
Gene Namereceptor (calcitonin) activity modifying protein 2
Synonyms
MMRRC Submission 042592-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4998 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101246028-101259546 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 101247421 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107282] [ENSMUST00000122006] [ENSMUST00000128260] [ENSMUST00000129680] [ENSMUST00000149585] [ENSMUST00000151830]
Predicted Effect probably benign
Transcript: ENSMUST00000107282
SMART Domains Protein: ENSMUSP00000102903
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
Pfam:RAMP 29 140 1.5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122006
SMART Domains Protein: ENSMUSP00000114061
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
PDB:2XVT|F 71 105 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128260
SMART Domains Protein: ENSMUSP00000127718
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129680
SMART Domains Protein: ENSMUSP00000122072
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Pfam:RAMP 80 187 6.7e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149006
Predicted Effect probably benign
Transcript: ENSMUST00000149585
SMART Domains Protein: ENSMUSP00000116331
Gene: ENSMUSG00000001240

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151830
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP2) protein, CRLR functions as an adrenomedullin receptor. The RAMP2 protein is involved in core glycosylation and transportation of adrenomedullin receptor to the cell surface. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality. Mice heterozygous for the null allele exhibit decreased litter size beyond the loss of homozygous embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enox1 A T 14: 77,501,435 probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Espn A T 4: 152,135,583 M361K possibly damaging Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Kif27 A G 13: 58,293,143 S1153P probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Mmel1 A G 4: 154,885,510 K177R probably benign Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Npepps A G 11: 97,206,107 probably benign Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pdpr G T 8: 111,114,768 V211F probably damaging Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Rap1gap A G 4: 137,728,284 D381G possibly damaging Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem132a G T 19: 10,858,941 P742T probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Ramp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Ramp2 APN 11 101247627 missense probably benign 0.37
R1518:Ramp2 UTSW 11 101247582 missense probably benign 0.22
R2218:Ramp2 UTSW 11 101247631 missense probably benign 0.00
R2566:Ramp2 UTSW 11 101246545 unclassified probably benign
R3412:Ramp2 UTSW 11 101246545 unclassified probably benign
R4967:Ramp2 UTSW 11 101247557 splice site probably null
X0018:Ramp2 UTSW 11 101246545 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGAGGACCAACTGATGC -3'
(R):5'- GCAAGGTAGGACATGTGTTTC -3'

Sequencing Primer
(F):5'- GAGGACCAACTGATGCCCTCTAAC -3'
(R):5'- CAAGGTAGGACATGTGTTTCGTAGTC -3'
Posted On2016-06-06