Incidental Mutation 'R4998:Kif27'
ID389672
Institutional Source Beutler Lab
Gene Symbol Kif27
Ensembl Gene ENSMUSG00000060176
Gene Namekinesin family member 27
Synonyms4930517I18Rik
MMRRC Submission 042592-MU
Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R4998 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58287502-58359122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58293143 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1153 (S1153P)
Ref Sequence ENSEMBL: ENSMUSP00000153598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]
Predicted Effect probably damaging
Transcript: ENSMUST00000043605
AA Change: S1153P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: S1153P

DomainStartEndE-ValueType
KISc 3 349 9.18e-160 SMART
low complexity region 369 385 N/A INTRINSIC
coiled coil region 386 418 N/A INTRINSIC
Blast:KISc 486 566 5e-29 BLAST
coiled coil region 710 790 N/A INTRINSIC
coiled coil region 835 891 N/A INTRINSIC
coiled coil region 916 972 N/A INTRINSIC
low complexity region 993 1008 N/A INTRINSIC
coiled coil region 1010 1078 N/A INTRINSIC
coiled coil region 1186 1226 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190479
Predicted Effect probably benign
Transcript: ENSMUST00000224694
Predicted Effect probably damaging
Transcript: ENSMUST00000225388
AA Change: S1153P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
MGI Phenotype Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enox1 A T 14: 77,501,435 probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Espn A T 4: 152,135,583 M361K possibly damaging Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Mmel1 A G 4: 154,885,510 K177R probably benign Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Npepps A G 11: 97,206,107 probably benign Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pdpr G T 8: 111,114,768 V211F probably damaging Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Ramp2 T A 11: 101,247,421 probably benign Het
Rap1gap A G 4: 137,728,284 D381G possibly damaging Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem132a G T 19: 10,858,941 P742T probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Kif27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kif27 APN 13 58337604 missense probably benign
IGL00421:Kif27 APN 13 58343889 missense probably damaging 1.00
IGL00903:Kif27 APN 13 58344672 missense possibly damaging 0.69
IGL01024:Kif27 APN 13 58288201 missense possibly damaging 0.71
IGL01070:Kif27 APN 13 58344093 missense probably damaging 1.00
IGL01761:Kif27 APN 13 58337645 missense probably benign
IGL02160:Kif27 APN 13 58325998 missense probably damaging 1.00
IGL03162:Kif27 APN 13 58311207 missense probably benign 0.03
P0016:Kif27 UTSW 13 58303452 nonsense probably null
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0481:Kif27 UTSW 13 58311264 splice site probably benign
R0960:Kif27 UTSW 13 58323967 missense probably damaging 0.99
R1015:Kif27 UTSW 13 58320215 missense probably damaging 1.00
R1205:Kif27 UTSW 13 58344205 missense probably benign 0.00
R1478:Kif27 UTSW 13 58303545 missense probably damaging 0.98
R1789:Kif27 UTSW 13 58344008 missense probably damaging 1.00
R1959:Kif27 UTSW 13 58293123 missense probably benign 0.00
R1961:Kif27 UTSW 13 58293123 missense probably benign 0.00
R3508:Kif27 UTSW 13 58313212 missense possibly damaging 0.88
R4168:Kif27 UTSW 13 58345748 missense probably benign 0.01
R4247:Kif27 UTSW 13 58287917 missense probably damaging 0.98
R4307:Kif27 UTSW 13 58344123 missense probably benign 0.00
R4621:Kif27 UTSW 13 58331013 missense probably benign 0.13
R4660:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4661:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4736:Kif27 UTSW 13 58328971 missense probably benign 0.04
R4770:Kif27 UTSW 13 58344377 missense probably damaging 1.00
R4853:Kif27 UTSW 13 58311258 missense probably benign 0.06
R4963:Kif27 UTSW 13 58328994 missense possibly damaging 0.85
R5134:Kif27 UTSW 13 58291090 missense possibly damaging 0.80
R5225:Kif27 UTSW 13 58293101 missense possibly damaging 0.88
R5835:Kif27 UTSW 13 58313146 critical splice donor site probably null
R5875:Kif27 UTSW 13 58311104 missense probably benign 0.01
R5929:Kif27 UTSW 13 58343970 missense probably benign 0.01
R6175:Kif27 UTSW 13 58311237 missense probably damaging 1.00
R6446:Kif27 UTSW 13 58345716 missense probably damaging 1.00
R6628:Kif27 UTSW 13 58354797 missense probably damaging 1.00
Z1088:Kif27 UTSW 13 58288033 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGCATCTGTAAGCATTGACTG -3'
(R):5'- TGTAGTCCAAGAAAACTGGGC -3'

Sequencing Primer
(F):5'- CTGTAAGCATTGACTGTGCAC -3'
(R):5'- GTCCAAGAAAACTGGGCAATCTATTG -3'
Posted On2016-06-06