Incidental Mutation 'R4998:Enox1'
ID389675
Institutional Source Beutler Lab
Gene Symbol Enox1
Ensembl Gene ENSMUSG00000022012
Gene Nameecto-NOX disulfide-thiol exchanger 1
SynonymsD230005D02Rik
MMRRC Submission 042592-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4998 (G1)
Quality Score224
Status Validated
Chromosome14
Chromosomal Location77156763-77721760 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 77501435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022589] [ENSMUST00000227662] [ENSMUST00000227831]
Predicted Effect probably benign
Transcript: ENSMUST00000022589
SMART Domains Protein: ENSMUSP00000022589
Gene: ENSMUSG00000022012

DomainStartEndE-ValueType
low complexity region 95 105 N/A INTRINSIC
RRM 143 209 2.41e-8 SMART
low complexity region 233 251 N/A INTRINSIC
coiled coil region 307 342 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
coiled coil region 425 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000088880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163416
Predicted Effect probably benign
Transcript: ENSMUST00000227662
Predicted Effect probably benign
Transcript: ENSMUST00000227831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228148
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in plasma membrane electron transport pathways. The encoded protein has both a hydroquinone (NADH) oxidase activity and a protein disulfide-thiol interchange activity. The two activities cycle with a periodicity of 24 minutes, with one activity being at its peak when the other is at its lowest. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Espn A T 4: 152,135,583 M361K possibly damaging Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Kif27 A G 13: 58,293,143 S1153P probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Mmel1 A G 4: 154,885,510 K177R probably benign Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Npepps A G 11: 97,206,107 probably benign Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pdpr G T 8: 111,114,768 V211F probably damaging Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Ramp2 T A 11: 101,247,421 probably benign Het
Rap1gap A G 4: 137,728,284 D381G possibly damaging Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem132a G T 19: 10,858,941 P742T probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Enox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Enox1 APN 14 77582404 missense possibly damaging 0.63
IGL01376:Enox1 APN 14 77251843 intron probably benign
IGL01509:Enox1 APN 14 77699273 missense probably damaging 1.00
IGL01684:Enox1 APN 14 77579093 missense possibly damaging 0.81
IGL01874:Enox1 APN 14 77579162 missense probably damaging 1.00
IGL03324:Enox1 APN 14 77615485 missense probably damaging 1.00
soft UTSW 14 77486017 intron probably benign
R0037:Enox1 UTSW 14 77699310 splice site probably benign
R0112:Enox1 UTSW 14 77699198 missense possibly damaging 0.77
R0543:Enox1 UTSW 14 77506959 splice site probably benign
R0569:Enox1 UTSW 14 77637677 missense probably damaging 0.99
R0708:Enox1 UTSW 14 77592912 missense probably benign 0.28
R0811:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R0812:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R1417:Enox1 UTSW 14 77486005 intron probably benign
R1654:Enox1 UTSW 14 77611374 missense possibly damaging 0.87
R1678:Enox1 UTSW 14 77577656 missense probably benign 0.00
R1817:Enox1 UTSW 14 77615475 missense possibly damaging 0.84
R1976:Enox1 UTSW 14 77668793 missense probably benign
R2520:Enox1 UTSW 14 77582399 missense probably damaging 0.99
R3880:Enox1 UTSW 14 77611386 missense possibly damaging 0.49
R4096:Enox1 UTSW 14 77577720 missense probably damaging 0.99
R4885:Enox1 UTSW 14 77720850 missense probably damaging 1.00
R5110:Enox1 UTSW 14 77707687 critical splice donor site probably null
R5341:Enox1 UTSW 14 77577656 missense possibly damaging 0.94
R5469:Enox1 UTSW 14 77592974 missense probably benign 0.00
R5596:Enox1 UTSW 14 77579053 missense probably benign 0.42
R5833:Enox1 UTSW 14 77506939 missense probably benign 0.01
R5892:Enox1 UTSW 14 77486017 intron probably benign
R6174:Enox1 UTSW 14 77508187 missense possibly damaging 0.93
R6267:Enox1 UTSW 14 77577764 missense probably damaging 1.00
R6867:Enox1 UTSW 14 77699299 critical splice donor site probably null
R7069:Enox1 UTSW 14 77611324 missense probably damaging 0.99
R7219:Enox1 UTSW 14 77720844 missense probably benign 0.15
R7316:Enox1 UTSW 14 77720858 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCTCCTTGAGGCTGAGC -3'
(R):5'- AGAGATACCCTAGGATCCTAGATG -3'

Sequencing Primer
(F):5'- CTTGAGGCTGAGCAGGGG -3'
(R):5'- GTCTGGTAAATATACAGGATTCTGAC -3'
Posted On2016-06-06