Incidental Mutation 'R4998:Tmem132a'
ID389690
Institutional Source Beutler Lab
Gene Symbol Tmem132a
Ensembl Gene ENSMUSG00000024736
Gene Nametransmembrane protein 132A
SynonymsHspa5bp1, 6720481D13Rik
MMRRC Submission 042592-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4998 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10857822-10869940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10858941 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 742 (P742T)
Ref Sequence ENSEMBL: ENSMUSP00000025645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025645] [ENSMUST00000025646] [ENSMUST00000120524]
Predicted Effect probably benign
Transcript: ENSMUST00000025645
AA Change: P742T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025645
Gene: ENSMUSG00000024736
AA Change: P742T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:TMEM132D_N 44 167 1.6e-35 PFAM
low complexity region 206 223 N/A INTRINSIC
Pfam:TMEM132 403 745 4.1e-108 PFAM
low complexity region 759 776 N/A INTRINSIC
Pfam:TMEM132D_C 809 897 1.5e-31 PFAM
low complexity region 906 923 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 960 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025646
SMART Domains Protein: ENSMUSP00000025646
Gene: ENSMUSG00000024737

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
Pfam:MFS_1 38 508 3.4e-10 PFAM
Pfam:PTR2 101 519 3.2e-79 PFAM
transmembrane domain 538 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120524
SMART Domains Protein: ENSMUSP00000113696
Gene: ENSMUSG00000024736

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138263
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the rat Grp78-binding protein (GBP). Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,663 V135A probably damaging Het
Ankrd42 T C 7: 92,624,074 N115S possibly damaging Het
Baz1a T C 12: 54,975,137 E120G probably damaging Het
Calcrl A T 2: 84,339,314 V341E probably damaging Het
Card6 T C 15: 5,100,082 R611G probably benign Het
Cd70 A T 17: 57,146,311 S118T probably damaging Het
Chil5 T A 3: 106,019,932 I188F probably damaging Het
Clca4b C T 3: 144,915,508 V602I probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Col6a4 A G 9: 105,990,778 probably benign Het
Cox8b T C 7: 140,899,088 E38G probably damaging Het
Cx3cl1 C G 8: 94,780,425 L353V probably damaging Het
Cyp2a4 G T 7: 26,307,361 Q48H probably damaging Het
Defb8 T C 8: 19,447,587 I3V probably benign Het
Dip2a A T 10: 76,319,556 L65* probably null Het
Dsg2 A T 18: 20,601,521 D852V probably benign Het
Dyx1c1 A G 9: 72,960,678 T74A possibly damaging Het
Edar T C 10: 58,606,093 R326G probably damaging Het
Egfr A G 11: 16,881,493 E554G possibly damaging Het
Eif2b3 A C 4: 117,066,392 K268T probably benign Het
Enox1 A T 14: 77,501,435 probably benign Het
Enpp3 C A 10: 24,807,538 M260I probably benign Het
Espn A T 4: 152,135,583 M361K possibly damaging Het
Fam107a T C 14: 8,299,514 N108S possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fbn2 A T 18: 58,072,631 V1125D probably damaging Het
Fbxo30 T A 10: 11,290,763 S410T probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fuk G A 8: 110,887,803 A618V probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm17416 C A 2: 152,569,507 P57Q probably damaging Het
Gm27013 A T 6: 130,676,538 C654S probably damaging Het
Gm9495 G C 8: 69,453,358 N13K probably benign Het
Gon4l G T 3: 88,899,998 E1666D probably damaging Het
Gypa T A 8: 80,496,335 S23T unknown Het
Gys1 C A 7: 45,451,544 probably benign Het
Hdac10 T A 15: 89,123,940 Q569L possibly damaging Het
Icos A G 1: 60,993,782 T47A possibly damaging Het
Igfn1 T A 1: 135,954,666 I2814F probably damaging Het
Kif27 A G 13: 58,293,143 S1153P probably damaging Het
Lin28a A C 4: 134,018,717 F9V possibly damaging Het
Lrriq3 T A 3: 155,188,058 N465K probably benign Het
Lsm14a T C 7: 34,375,374 E47G probably damaging Het
Mmel1 A G 4: 154,885,510 K177R probably benign Het
Ncstn T A 1: 172,071,520 N348I possibly damaging Het
Ninl A G 2: 150,953,364 I619T probably damaging Het
Npb T C 11: 120,608,575 Y23H probably damaging Het
Npepps A G 11: 97,206,107 probably benign Het
Olfr1076 T C 2: 86,509,355 Y299H probably benign Het
Otop1 G A 5: 38,294,548 probably null Het
Pcdha1 T C 18: 36,932,416 L711P probably damaging Het
Pcyt1a A G 16: 32,451,842 probably benign Het
Pdpr G T 8: 111,114,768 V211F probably damaging Het
Pip4k2b T C 11: 97,722,435 N245S possibly damaging Het
Platr26 G A 2: 71,730,870 noncoding transcript Het
Plek A G 11: 16,983,194 probably null Het
Prdm15 A T 16: 97,794,489 D1046E probably damaging Het
Prr29 T G 11: 106,376,953 C175G probably benign Het
Ptpru A G 4: 131,776,885 V1097A probably damaging Het
Ramp2 T A 11: 101,247,421 probably benign Het
Rap1gap A G 4: 137,728,284 D381G possibly damaging Het
Rbbp6 T A 7: 122,990,326 D412E probably benign Het
Rgs4 C T 1: 169,745,233 V45I probably benign Het
Ryr2 C T 13: 11,643,895 R3614Q probably damaging Het
Shc3 G A 13: 51,442,820 probably null Het
Shmt2 A T 10: 127,518,270 C412S probably damaging Het
Slc25a45 A T 19: 5,884,917 N265Y probably damaging Het
Slc4a10 G C 2: 62,244,439 E316Q probably benign Het
Slc5a8 T C 10: 88,908,057 probably null Het
Snx31 A G 15: 36,539,367 V121A probably damaging Het
Socs3 T C 11: 117,967,716 E172G probably damaging Het
Tg A G 15: 66,674,050 D207G probably damaging Het
Them4 G T 3: 94,329,781 V183F probably damaging Het
Tkt G A 14: 30,565,542 W136* probably null Het
Tmc3 C A 7: 83,622,321 R894S probably benign Het
Tmem202 A G 9: 59,524,846 L66P probably damaging Het
Trbc1 G A 6: 41,539,336 probably benign Het
Trhr2 A G 8: 122,358,772 F158L probably benign Het
Ttc13 A T 8: 124,680,056 N595K probably damaging Het
Ucp1 A G 8: 83,297,855 probably null Het
Zbtb4 C T 11: 69,778,671 T740I probably benign Het
Zfp69 A T 4: 120,947,325 D116E possibly damaging Het
Zfp879 A G 11: 50,837,969 L66S probably damaging Het
Zfp955b T A 17: 33,305,151 probably benign Het
Zfyve1 T C 12: 83,548,065 I718V possibly damaging Het
Other mutations in Tmem132a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Tmem132a APN 19 10861524 splice site probably benign
IGL02508:Tmem132a APN 19 10858518 missense probably damaging 1.00
R0514:Tmem132a UTSW 19 10858991 missense probably damaging 0.99
R0918:Tmem132a UTSW 19 10858113 missense probably damaging 1.00
R1160:Tmem132a UTSW 19 10858574 missense probably damaging 0.98
R1205:Tmem132a UTSW 19 10859084 missense probably benign 0.03
R1619:Tmem132a UTSW 19 10861698 missense probably damaging 1.00
R1777:Tmem132a UTSW 19 10858506 missense probably damaging 1.00
R1815:Tmem132a UTSW 19 10861567 nonsense probably null
R1869:Tmem132a UTSW 19 10858688 missense possibly damaging 0.48
R1888:Tmem132a UTSW 19 10863499 missense probably damaging 1.00
R1888:Tmem132a UTSW 19 10863499 missense probably damaging 1.00
R2133:Tmem132a UTSW 19 10864066 missense probably benign 0.26
R2441:Tmem132a UTSW 19 10860137 missense probably damaging 0.96
R2570:Tmem132a UTSW 19 10859742 missense probably null 1.00
R3157:Tmem132a UTSW 19 10859537 nonsense probably null
R3159:Tmem132a UTSW 19 10859537 nonsense probably null
R4152:Tmem132a UTSW 19 10859063 missense probably benign 0.04
R4281:Tmem132a UTSW 19 10861726 missense possibly damaging 0.81
R4547:Tmem132a UTSW 19 10860200 missense possibly damaging 0.83
R4793:Tmem132a UTSW 19 10865493 missense probably damaging 1.00
R4947:Tmem132a UTSW 19 10866934 missense possibly damaging 0.90
R5226:Tmem132a UTSW 19 10867144 missense possibly damaging 0.50
R5323:Tmem132a UTSW 19 10864007 missense possibly damaging 0.81
R6659:Tmem132a UTSW 19 10860321 missense probably damaging 0.99
R6814:Tmem132a UTSW 19 10863305 missense probably damaging 1.00
R6872:Tmem132a UTSW 19 10863305 missense probably damaging 1.00
R7205:Tmem132a UTSW 19 10866931 missense probably damaging 1.00
Z1088:Tmem132a UTSW 19 10858935 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCCTAATACCCACATGG -3'
(R):5'- GTGGCAGACAGGTGATTGAC -3'

Sequencing Primer
(F):5'- TAATACCCACATGGCCCCC -3'
(R):5'- TGATTGACACGCGTCCC -3'
Posted On2016-06-06