Incidental Mutation 'R4999:Ttll7'
ID389703
Institutional Source Beutler Lab
Gene Symbol Ttll7
Ensembl Gene ENSMUSG00000036745
Gene Nametubulin tyrosine ligase-like family, member 7
Synonyms1110049N09Rik, 4921517B04Rik
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146852367-146984009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146894469 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 44 (N44S)
Ref Sequence ENSEMBL: ENSMUSP00000129369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000124743] [ENSMUST00000170055]
Predicted Effect probably damaging
Transcript: ENSMUST00000037942
AA Change: N44S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038090
SMART Domains Protein: ENSMUSP00000037875
Gene: ENSMUSG00000036745

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106134
AA Change: N44S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: N44S

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 7.2e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124743
Predicted Effect probably damaging
Transcript: ENSMUST00000170055
AA Change: N44S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: N44S

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 5.9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Ttll7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ttll7 APN 3 146909582 missense possibly damaging 0.72
IGL01353:Ttll7 APN 3 146961719 missense probably damaging 1.00
IGL01415:Ttll7 APN 3 146909599 missense possibly damaging 0.90
IGL01843:Ttll7 APN 3 146940021 missense possibly damaging 0.93
IGL03101:Ttll7 APN 3 146896690 missense possibly damaging 0.82
IGL03378:Ttll7 APN 3 146909653 missense probably benign 0.06
P0038:Ttll7 UTSW 3 146945184 missense possibly damaging 0.80
R0265:Ttll7 UTSW 3 146944160 nonsense probably null
R0358:Ttll7 UTSW 3 146944116 missense probably benign
R0363:Ttll7 UTSW 3 146944215 missense probably benign 0.00
R0364:Ttll7 UTSW 3 146945181 missense possibly damaging 0.82
R0751:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1184:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1533:Ttll7 UTSW 3 146896667 missense probably damaging 1.00
R1771:Ttll7 UTSW 3 146894405 missense probably benign 0.02
R1789:Ttll7 UTSW 3 146915780 missense probably damaging 1.00
R1961:Ttll7 UTSW 3 146915795 splice site probably benign
R1995:Ttll7 UTSW 3 146961755 missense possibly damaging 0.95
R2083:Ttll7 UTSW 3 146930104 missense possibly damaging 0.77
R2152:Ttll7 UTSW 3 146930189 missense probably damaging 1.00
R2655:Ttll7 UTSW 3 146947621 missense probably damaging 1.00
R2926:Ttll7 UTSW 3 146930415 nonsense probably null
R4888:Ttll7 UTSW 3 146894177 start codon destroyed probably null 0.99
R5648:Ttll7 UTSW 3 146961710 missense probably damaging 1.00
R5937:Ttll7 UTSW 3 146944092 nonsense probably null
R6009:Ttll7 UTSW 3 146934535 missense probably damaging 0.99
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6463:Ttll7 UTSW 3 146931582 missense possibly damaging 0.86
R6747:Ttll7 UTSW 3 146944056 missense probably benign 0.02
R6922:Ttll7 UTSW 3 146909614 missense possibly damaging 0.92
R7123:Ttll7 UTSW 3 146913296 missense possibly damaging 0.95
R7211:Ttll7 UTSW 3 146913276 missense probably damaging 0.97
X0024:Ttll7 UTSW 3 146909553 missense probably damaging 1.00
X0026:Ttll7 UTSW 3 146961695 missense probably damaging 1.00
X0027:Ttll7 UTSW 3 146947653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTCACCGTTCGTAGC -3'
(R):5'- CCACTGCATGGGAAAAGAATTC -3'

Sequencing Primer
(F):5'- GTAGCTTTAACCTGCTAGACGC -3'
(R):5'- TGCATGGGAAAAGAATTCTTCTAATC -3'
Posted On2016-06-06