Incidental Mutation 'R4999:Ctbp2'
ID389738
Institutional Source Beutler Lab
Gene Symbol Ctbp2
Ensembl Gene ENSMUSG00000030970
Gene NameC-terminal binding protein 2
SynonymsD7Ertd45e, Gtrgeo6, Ribeye
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location132987563-133124354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 133014649 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 186 (P186T)
Ref Sequence ENSEMBL: ENSMUSP00000130294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033269] [ENSMUST00000124096] [ENSMUST00000163601] [ENSMUST00000165457] [ENSMUST00000166439] [ENSMUST00000167218] [ENSMUST00000168958] [ENSMUST00000169570] [ENSMUST00000170459] [ENSMUST00000172341]
Predicted Effect probably benign
Transcript: ENSMUST00000033269
SMART Domains Protein: ENSMUSP00000033269
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 358 2.9e-31 PFAM
Pfam:2-Hacid_dh_C 139 323 1.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164739
SMART Domains Protein: ENSMUSP00000130157
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164896
SMART Domains Protein: ENSMUSP00000129195
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165534
SMART Domains Protein: ENSMUSP00000132311
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166400
SMART Domains Protein: ENSMUSP00000131868
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166439
SMART Domains Protein: ENSMUSP00000127448
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 11 333 2.4e-31 PFAM
Pfam:2-Hacid_dh_C 114 298 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167218
Predicted Effect probably benign
Transcript: ENSMUST00000168958
SMART Domains Protein: ENSMUSP00000132892
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 164 6.3e-27 PFAM
Pfam:2-Hacid_dh_C 122 188 8.5e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169570
AA Change: P186T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130294
Gene: ENSMUSG00000030970
AA Change: P186T

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 579 901 2.8e-31 PFAM
Pfam:2-Hacid_dh_C 682 866 5.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171727
SMART Domains Protein: ENSMUSP00000127123
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172341
SMART Domains Protein: ENSMUSP00000127701
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 177 5.6e-27 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Embryos homozygous for a gene-trapped allele die by E10 exhibiting a small size, axial truncations, a thin neural epithelium, a dilated pericardium, delayed fore- and midbrain development, and defects in heart morphogenesis, placental development and extraembryonic vascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Ctbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Ctbp2 APN 7 132991156 missense probably damaging 0.98
IGL02615:Ctbp2 APN 7 132995347 missense probably benign 0.34
IGL02626:Ctbp2 APN 7 132999211 missense probably benign 0.12
PIT4802001:Ctbp2 UTSW 7 132988245 missense possibly damaging 0.77
R0068:Ctbp2 UTSW 7 132990059 missense possibly damaging 0.95
R0374:Ctbp2 UTSW 7 132999344 missense possibly damaging 0.89
R0566:Ctbp2 UTSW 7 132991147 missense probably damaging 1.00
R0571:Ctbp2 UTSW 7 133014805 missense probably damaging 1.00
R1247:Ctbp2 UTSW 7 132995189 missense probably benign 0.24
R1292:Ctbp2 UTSW 7 133015189 missense probably damaging 1.00
R1477:Ctbp2 UTSW 7 132998941 missense probably damaging 1.00
R1732:Ctbp2 UTSW 7 132998924 missense possibly damaging 0.80
R1807:Ctbp2 UTSW 7 133014408 missense probably benign 0.00
R1865:Ctbp2 UTSW 7 132990554 missense probably benign 0.02
R1951:Ctbp2 UTSW 7 133015027 missense probably benign
R2393:Ctbp2 UTSW 7 133023561 critical splice donor site probably null
R2410:Ctbp2 UTSW 7 133014354 missense probably benign 0.08
R3427:Ctbp2 UTSW 7 132991592 missense probably damaging 1.00
R4004:Ctbp2 UTSW 7 132991773 missense probably benign 0.31
R4243:Ctbp2 UTSW 7 132998854 missense probably benign 0.43
R4754:Ctbp2 UTSW 7 133023558 splice site probably null
R4820:Ctbp2 UTSW 7 133013694 missense probably damaging 0.98
R4947:Ctbp2 UTSW 7 132999283 missense probably damaging 1.00
R4960:Ctbp2 UTSW 7 133014238 missense probably benign 0.00
R5340:Ctbp2 UTSW 7 133013963 missense probably benign 0.43
R5593:Ctbp2 UTSW 7 132998869 missense possibly damaging 0.95
R5762:Ctbp2 UTSW 7 132995359 missense probably damaging 1.00
R6913:Ctbp2 UTSW 7 133014726 missense possibly damaging 0.94
R7044:Ctbp2 UTSW 7 133015102 missense possibly damaging 0.71
R7342:Ctbp2 UTSW 7 133014312 missense probably damaging 0.99
R7358:Ctbp2 UTSW 7 132998881 missense probably damaging 1.00
R7376:Ctbp2 UTSW 7 133013968 missense possibly damaging 0.93
R7393:Ctbp2 UTSW 7 132988292 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAGCCAGCTTTGAATGGATGC -3'
(R):5'- AGCTACGGAATGCTTGGCAG -3'

Sequencing Primer
(F):5'- GCCCATAGCCTCTATTCAGGG -3'
(R):5'- GCTTGGCAGCAGAATGC -3'
Posted On2016-06-06