Incidental Mutation 'R4999:Grm2'
ID389748
Institutional Source Beutler Lab
Gene Symbol Grm2
Ensembl Gene ENSMUSG00000023192
Gene Nameglutamate receptor, metabotropic 2
Synonyms4930441L02Rik, mGluR2, Gprc1b
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R4999 (G1)
Quality Score174
Status Not validated
Chromosome9
Chromosomal Location106643095-106656082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106653990 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 100 (E100G)
Ref Sequence ENSEMBL: ENSMUSP00000023959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023959] [ENSMUST00000046735] [ENSMUST00000163441] [ENSMUST00000169068] [ENSMUST00000201681]
Predicted Effect probably damaging
Transcript: ENSMUST00000023959
AA Change: E100G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023959
Gene: ENSMUSG00000023192
AA Change: E100G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 1.3e-96 PFAM
Pfam:NCD3G 496 546 3.7e-13 PFAM
Pfam:7tm_3 579 816 4.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046735
SMART Domains Protein: ENSMUSP00000044654
Gene: ENSMUSG00000040813

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:GyrI-like 41 185 1e-12 PFAM
low complexity region 208 225 N/A INTRINSIC
low complexity region 258 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163441
SMART Domains Protein: ENSMUSP00000132247
Gene: ENSMUSG00000040813

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1jyha_ 46 133 7e-3 SMART
low complexity region 208 225 N/A INTRINSIC
low complexity region 258 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169068
SMART Domains Protein: ENSMUSP00000133194
Gene: ENSMUSG00000040813

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:GyrI-like 41 176 4.2e-11 PFAM
low complexity region 220 253 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201681
AA Change: E100G
SMART Domains Protein: ENSMUSP00000144631
Gene: ENSMUSG00000023192
AA Change: E100G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 4.1e-95 PFAM
Pfam:7tm_3 458 538 4.6e-18 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile behavioral modifications and moderate abnormalities in long term depression and EPSP in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Grm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1053:Grm2 UTSW 9 106648157 missense probably damaging 0.98
R1116:Grm2 UTSW 9 106647927 missense probably damaging 0.97
R1593:Grm2 UTSW 9 106650914 missense probably damaging 1.00
R1619:Grm2 UTSW 9 106647471 missense probably damaging 1.00
R2174:Grm2 UTSW 9 106647795 missense probably benign 0.05
R2357:Grm2 UTSW 9 106647581 missense probably damaging 0.99
R3115:Grm2 UTSW 9 106647623 missense probably damaging 0.97
R4453:Grm2 UTSW 9 106653879 missense probably damaging 0.97
R4700:Grm2 UTSW 9 106653931 missense probably benign 0.18
R4854:Grm2 UTSW 9 106654132 missense possibly damaging 0.80
R4871:Grm2 UTSW 9 106647645 missense probably benign 0.00
R4888:Grm2 UTSW 9 106650666 missense probably damaging 0.98
R5617:Grm2 UTSW 9 106651076 unclassified probably null
R5620:Grm2 UTSW 9 106650446 missense probably damaging 0.96
R6021:Grm2 UTSW 9 106650800 missense probably damaging 1.00
R6089:Grm2 UTSW 9 106653891 missense probably damaging 1.00
R6662:Grm2 UTSW 9 106648053 missense probably benign 0.01
R7061:Grm2 UTSW 9 106651225 missense probably damaging 0.98
R7266:Grm2 UTSW 9 106647171 missense
R7270:Grm2 UTSW 9 106651058 missense probably damaging 0.98
R7479:Grm2 UTSW 9 106653851 missense possibly damaging 0.84
R7542:Grm2 UTSW 9 106651169 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTCCCTACTCATCAGGATCACTG -3'
(R):5'- TGTTCCCAGTGCACCAGAAG -3'

Sequencing Primer
(F):5'- CAGGATCACTGGTTCACCC -3'
(R):5'- GGGTGGCCCAGCAGAGG -3'
Posted On2016-06-06