Incidental Mutation 'R4999:Mta2'
ID389778
Institutional Source Beutler Lab
Gene Symbol Mta2
Ensembl Gene ENSMUSG00000071646
Gene Namemetastasis-associated gene family, member 2
SynonymsMta1l1, mmta2
MMRRC Submission 042593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8941875-8952303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8950383 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 523 (D523Y)
Ref Sequence ENSEMBL: ENSMUSP00000093959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096239] [ENSMUST00000096240]
Predicted Effect probably benign
Transcript: ENSMUST00000096239
SMART Domains Protein: ENSMUSP00000093958
Gene: ENSMUSG00000071645

DomainStartEndE-ValueType
ZnF_C2H2 16 40 1.53e-1 SMART
RRM 57 124 2.02e-10 SMART
SCOP:d1f5aa2 173 221 1e-3 SMART
low complexity region 242 258 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 324 347 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
Pfam:PAP_assoc 493 552 2.7e-8 PFAM
low complexity region 594 618 N/A INTRINSIC
low complexity region 767 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096240
AA Change: D523Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093959
Gene: ENSMUSG00000071646
AA Change: D523Y

DomainStartEndE-ValueType
BAH 4 144 7.34e-34 SMART
ELM2 147 201 5.58e-15 SMART
SANT 264 313 2.24e-7 SMART
ZnF_GATA 361 415 5.5e-15 SMART
low complexity region 475 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169535
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been identified as a component of NuRD, a nucleosome remodeling deacetylase complex identified in the nucleus of human cells. It shows a very broad expression pattern and is strongly expressed in many tissues. It may represent one member of a small gene family that encode different but related proteins involved either directly or indirectly in transcriptional regulation. Their indirect effects on transcriptional regulation may include chromatin remodeling. It is closely related to another member of this family, a protein that has been correlated with the metastatic potential of certain carcinomas. These two proteins are so closely related that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. One of the proteins known to be a target protein for this gene product is p53. Deacetylation of p53 is correlated with a loss of growth inhibition in transformed cells supporting a connection between these gene family members and metastasis. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit partial embryonic and perinatal lethality, reduced weight, shortened lifespan, and increased susceptibility to systemic lupus erythematosus with increased T cell proliferation under Th2 conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Dntt T C 19: 41,039,856 V197A probably damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Mta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Mta2 APN 19 8947101 missense probably benign 0.23
IGL01098:Mta2 APN 19 8946717 missense probably damaging 0.98
IGL01148:Mta2 APN 19 8948304 missense probably damaging 0.98
IGL01897:Mta2 APN 19 8947766 nonsense probably null
IGL02054:Mta2 APN 19 8950912 missense probably benign
IGL02157:Mta2 APN 19 8947249 splice site probably benign
IGL02452:Mta2 APN 19 8950306 missense probably benign 0.00
IGL02563:Mta2 APN 19 8948051 missense probably benign
IGL02626:Mta2 APN 19 8949168 missense probably damaging 1.00
IGL02695:Mta2 APN 19 8948364 missense probably benign 0.01
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1208:Mta2 UTSW 19 8951017 missense probably damaging 1.00
R1301:Mta2 UTSW 19 8949186 splice site probably benign
R1731:Mta2 UTSW 19 8947724 splice site probably null
R1990:Mta2 UTSW 19 8942332 unclassified probably benign
R2116:Mta2 UTSW 19 8943516 missense probably damaging 1.00
R2117:Mta2 UTSW 19 8943516 missense probably damaging 1.00
R4614:Mta2 UTSW 19 8948128 splice site probably null
R4710:Mta2 UTSW 19 8949153 missense probably damaging 1.00
R4801:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4802:Mta2 UTSW 19 8945851 missense probably damaging 1.00
R4947:Mta2 UTSW 19 8946291 missense possibly damaging 0.68
R5340:Mta2 UTSW 19 8942356 start codon destroyed probably null 0.89
R5518:Mta2 UTSW 19 8948092 missense probably benign 0.01
R6044:Mta2 UTSW 19 8948331 missense probably damaging 0.99
R7096:Mta2 UTSW 19 8947775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCACTGCAGAGTACCCAG -3'
(R):5'- ACAAAAGCTCTAAGTTGTGTGGAC -3'

Sequencing Primer
(F):5'- TTCTCACTGCAGAGTACCCAGG -3'
(R):5'- CTCAGTGTCAAAGAAAAACTCTGG -3'
Posted On2016-06-06