Incidental Mutation 'R4999:Dntt'
ID389781
Institutional Source Beutler Lab
Gene Symbol Dntt
Ensembl Gene ENSMUSG00000025014
Gene Namedeoxynucleotidyltransferase, terminal
SynonymsTdt
MMRRC Submission 042593-MU
Accession Numbers

Genbank: NM_009345 ; MGI: 98659

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4999 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41029275-41059523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41039856 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 197 (V197A)
Ref Sequence ENSEMBL: ENSMUSP00000107819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000112200]
Predicted Effect probably damaging
Transcript: ENSMUST00000051806
AA Change: V197A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014
AA Change: V197A

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112200
AA Change: V197A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014
AA Change: V197A

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444P10Rik A G 1: 16,068,798 probably null Het
Abca4 T A 3: 122,105,370 V667D probably damaging Het
Aco1 A G 4: 40,176,507 I224V probably damaging Het
Arel1 C T 12: 84,931,767 V364M probably damaging Het
Arhgap42 A G 9: 9,009,434 V484A probably damaging Het
Asap2 T C 12: 21,252,765 F681L probably benign Het
Atrn C A 2: 130,975,954 D809E probably damaging Het
BC037034 T A 5: 138,261,622 T391S probably damaging Het
Ccdc70 G A 8: 21,973,250 V19M possibly damaging Het
Ccp110 G T 7: 118,730,012 E73* probably null Het
Cfap57 A C 4: 118,595,848 S553A probably benign Het
Cftr A G 6: 18,221,614 K212E probably benign Het
Chkb A T 15: 89,428,165 Y216N probably damaging Het
Cntnap2 G T 6: 45,920,834 D149Y probably damaging Het
Cpd A G 11: 76,846,222 probably null Het
Creb3l1 C T 2: 91,983,226 D489N probably benign Het
Crhbp A G 13: 95,442,245 F123L probably damaging Het
Cryab T C 9: 50,754,609 V100A possibly damaging Het
Csmd2 T C 4: 128,521,930 I2684T probably benign Het
Ctbp2 G T 7: 133,014,649 P186T possibly damaging Het
Ctnna2 T C 6: 76,915,762 N814S possibly damaging Het
Fam135a G A 1: 24,020,677 A1187V possibly damaging Het
Filip1l A T 16: 57,570,415 Q455H probably benign Het
Grm2 T C 9: 106,653,990 E100G probably damaging Het
Gtf2ird2 G A 5: 134,217,464 V855M probably damaging Het
Heatr9 A T 11: 83,518,792 I118N possibly damaging Het
Htra3 T C 5: 35,671,125 H137R probably benign Het
Iars A G 13: 49,709,661 S530G probably damaging Het
Klhdc4 T A 8: 121,796,603 M510L probably benign Het
Lipc T C 9: 70,816,731 T204A probably benign Het
Lrp1 A G 10: 127,553,779 V3129A probably damaging Het
Macf1 G A 4: 123,494,909 T1120I probably benign Het
Map4 T C 9: 110,038,377 probably benign Het
Mbtps1 A T 8: 119,533,348 V420D probably damaging Het
Mta2 G T 19: 8,950,383 D523Y probably benign Het
Muc4 A G 16: 32,756,296 probably benign Het
Mug1 C T 6: 121,878,943 Q965* probably null Het
Myo1e T A 9: 70,353,312 I584N probably damaging Het
Nolc1 T C 19: 46,078,920 V80A probably damaging Het
Nop56 G T 2: 130,275,725 V91L probably benign Het
Olfr1451 A T 19: 12,999,219 M78L probably benign Het
Olfr191 A T 16: 59,086,402 L27Q probably damaging Het
Olfr523 T C 7: 140,177,020 V300A probably damaging Het
Osbpl3 T C 6: 50,336,297 E107G probably damaging Het
Pde3a T A 6: 141,250,025 C146S probably benign Het
Pfkm A G 15: 98,128,242 M573V probably damaging Het
Pkd1l2 C T 8: 117,047,374 probably null Het
Plekhg3 T C 12: 76,565,247 I374T possibly damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Prom1 T G 5: 44,037,534 I290L probably benign Het
Rufy3 T A 5: 88,637,226 M387K probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d T A 5: 12,508,087 probably null Het
Sema6c C T 3: 95,168,363 T175I probably damaging Het
Serpina3k T C 12: 104,341,046 I179T probably damaging Het
Sf3b3 T C 8: 110,841,203 T207A probably benign Het
Slc22a26 C A 19: 7,802,181 R90L probably damaging Het
Slitrk5 T C 14: 111,680,216 V424A probably damaging Het
Smarca2 G T 19: 26,720,855 E89* probably null Het
Soga1 C T 2: 157,022,856 G1144D probably benign Het
Stab2 T A 10: 86,937,909 S853C probably damaging Het
Stk17b A T 1: 53,761,147 probably null Het
Taar5 T A 10: 23,971,547 I281N possibly damaging Het
Tarsl2 A T 7: 65,658,935 E284D probably damaging Het
Tbx15 C A 3: 99,316,333 T279K probably damaging Het
Tfr2 G A 5: 137,586,925 V740I probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tmem145 A G 7: 25,309,034 T302A probably benign Het
Tmem57 A G 4: 134,828,133 I343T probably benign Het
Trpa1 G T 1: 14,875,861 H1015Q probably benign Het
Tspan8 A G 10: 115,817,629 Y10C possibly damaging Het
Ttll7 A G 3: 146,894,469 N44S probably damaging Het
Uba7 T C 9: 107,979,839 probably null Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr5 C A 15: 38,009,668 A1022S probably benign Het
Usf1 T G 1: 171,415,763 I36S probably damaging Het
Vmn1r181 A T 7: 23,984,365 D85V probably damaging Het
Vmn1r3 A T 4: 3,185,009 Y99* probably null Het
Vmn1r72 T C 7: 11,670,373 I49M possibly damaging Het
Vmn2r99 A G 17: 19,362,135 M1V probably null Het
Vsig10 T A 5: 117,343,975 V410E probably damaging Het
Zc3h7b A G 15: 81,779,133 Y442C probably damaging Het
Zfyve26 G T 12: 79,280,385 Y730* probably null Het
Other mutations in Dntt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Dntt APN 19 41039823 missense probably benign 0.01
IGL01531:Dntt APN 19 41053238 nonsense probably null
IGL01859:Dntt APN 19 41037304 missense probably benign
IGL02053:Dntt APN 19 41046274 missense probably benign 0.00
IGL02411:Dntt APN 19 41052985 splice site probably null
IGL03180:Dntt APN 19 41029551 missense probably benign 0.09
R0106:Dntt UTSW 19 41055746 splice site probably benign
R0122:Dntt UTSW 19 41053038 missense possibly damaging 0.95
R0194:Dntt UTSW 19 41038970 missense possibly damaging 0.90
R0266:Dntt UTSW 19 41059127 missense probably damaging 0.99
R0377:Dntt UTSW 19 41047627 nonsense probably null
R0412:Dntt UTSW 19 41042933 missense probably damaging 1.00
R0604:Dntt UTSW 19 41053149 missense probably benign 0.01
R1350:Dntt UTSW 19 41037139 splice site probably benign
R1577:Dntt UTSW 19 41055785 missense probably damaging 1.00
R1677:Dntt UTSW 19 41029484 missense probably benign 0.26
R2567:Dntt UTSW 19 41041336 missense possibly damaging 0.81
R4380:Dntt UTSW 19 41053233 missense probably damaging 1.00
R4703:Dntt UTSW 19 41039803 missense probably benign 0.00
R6257:Dntt UTSW 19 41053062 missense probably damaging 1.00
R6757:Dntt UTSW 19 41037162 missense probably damaging 1.00
R7340:Dntt UTSW 19 41058565 critical splice acceptor site probably null
R7388:Dntt UTSW 19 41038979 missense probably benign 0.01
YA93:Dntt UTSW 19 41053187 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTTCAGTGACAGAGTCCC -3'
(R):5'- AGGAGAGAGCCCATACTTATGCG -3'

Sequencing Primer
(F):5'- GAGCTTGATCCTGACTCCAAAGG -3'
(R):5'- GAGAGCCCATACTTATGCGATCTG -3'
Posted On2016-06-06