Incidental Mutation 'R5000:Abi1'
ID389789
Institutional Source Beutler Lab
Gene Symbol Abi1
Ensembl Gene ENSMUSG00000058835
Gene Nameabl-interactor 1
SynonymsE3B1, Ssh3bp1
MMRRC Submission 042594-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R5000 (G1)
Quality Score174
Status Validated
Chromosome2
Chromosomal Location22940073-23040241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22950199 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 357 (R357W)
Ref Sequence ENSEMBL: ENSMUSP00000136846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078977] [ENSMUST00000091394] [ENSMUST00000093171] [ENSMUST00000114544] [ENSMUST00000123948] [ENSMUST00000126112] [ENSMUST00000139038] [ENSMUST00000140164] [ENSMUST00000149719] [ENSMUST00000153931] [ENSMUST00000178908]
Predicted Effect probably benign
Transcript: ENSMUST00000078977
SMART Domains Protein: ENSMUSP00000077997
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 364 N/A INTRINSIC
SH3 393 448 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091394
AA Change: R356W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088957
Gene: ENSMUSG00000058835
AA Change: R356W

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 4.1e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
SH3 421 476 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093171
SMART Domains Protein: ENSMUSP00000090860
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.7e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 281 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
low complexity region 336 363 N/A INTRINSIC
SH3 392 447 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114544
SMART Domains Protein: ENSMUSP00000110191
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 4.4e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 268 300 N/A INTRINSIC
SH3 329 384 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123948
AA Change: R357W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118491
Gene: ENSMUSG00000058835
AA Change: R357W

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 5.1e-39 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126112
AA Change: R352W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117335
Gene: ENSMUSG00000058835
AA Change: R352W

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 291 298 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 388 N/A INTRINSIC
SH3 417 472 2.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135308
Predicted Effect probably benign
Transcript: ENSMUST00000139038
AA Change: R298W

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116093
Gene: ENSMUSG00000058835
AA Change: R298W

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.4e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
low complexity region 307 334 N/A INTRINSIC
SH3 363 418 2.38e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140164
AA Change: R351W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120462
Gene: ENSMUSG00000058835
AA Change: R351W

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 8.6e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 360 387 N/A INTRINSIC
SH3 416 471 2.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148294
Predicted Effect probably benign
Transcript: ENSMUST00000149719
SMART Domains Protein: ENSMUSP00000120621
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 170 7.8e-37 PFAM
low complexity region 171 180 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 290 297 N/A INTRINSIC
low complexity region 331 358 N/A INTRINSIC
SH3 387 442 2.38e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153931
SMART Domains Protein: ENSMUSP00000120769
Gene: ENSMUSG00000058835

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3e-38 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 273 305 N/A INTRINSIC
SH3 334 389 2.38e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156344
Predicted Effect probably damaging
Transcript: ENSMUST00000178908
AA Change: R357W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136846
Gene: ENSMUSG00000058835
AA Change: R357W

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 3.9e-37 PFAM
low complexity region 176 185 N/A INTRINSIC
low complexity region 240 258 N/A INTRINSIC
low complexity region 264 282 N/A INTRINSIC
low complexity region 296 303 N/A INTRINSIC
low complexity region 337 352 N/A INTRINSIC
low complexity region 366 393 N/A INTRINSIC
SH3 422 477 2.38e-23 SMART
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive embryonic lethality prior during organogenesis associated with about abnormal vasculogenesis and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,556,521 F11Y probably benign Het
Abca5 A G 11: 110,310,224 L450P probably damaging Het
Acot7 G A 4: 152,186,363 G55R probably benign Het
Aicda G A 6: 122,561,867 V14I probably damaging Het
Anxa4 G T 6: 86,765,784 probably benign Het
Apobr T A 7: 126,586,557 D413E possibly damaging Het
Ash1l T C 3: 89,058,634 Y2448H probably damaging Het
Atf7ip A G 6: 136,582,428 E749G probably damaging Het
Atp8b3 A T 10: 80,521,842 N1114K possibly damaging Het
Bdnf C A 2: 109,723,648 N122K probably benign Het
Boc A T 16: 44,490,154 I801N probably damaging Het
Brap A T 5: 121,662,026 K37* probably null Het
Ccar1 C T 10: 62,751,005 E885K unknown Het
Ccdc103 A G 11: 102,884,106 N177S probably benign Het
Ccdc116 G A 16: 17,141,793 P344L possibly damaging Het
Cdca5 T C 19: 6,085,433 S28P possibly damaging Het
Ceacam20 T C 7: 19,965,528 I14T probably damaging Het
Chrnb1 A T 11: 69,787,032 V298E probably damaging Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Csnk1a1 T C 18: 61,578,769 F97L probably damaging Het
Dag1 A T 9: 108,208,017 S642T probably benign Het
Dedd2 A G 7: 25,203,643 V297A possibly damaging Het
Dhcr7 C T 7: 143,841,323 T189M possibly damaging Het
Dlgap1 T C 17: 70,766,058 S691P probably damaging Het
Dmgdh A C 13: 93,688,538 H123P probably damaging Het
Dnah6 C T 6: 73,144,815 V1395I probably benign Het
Dnah7a T C 1: 53,567,042 Y1273C probably damaging Het
Dnah7b T A 1: 46,099,503 L235* probably null Het
Elac2 T C 11: 64,985,553 F3L probably benign Het
Elovl7 A T 13: 108,274,381 K163N probably benign Het
Epg5 T C 18: 77,954,161 V413A probably benign Het
Espl1 T A 15: 102,298,551 L150Q probably damaging Het
F2rl3 T A 8: 72,762,679 L178Q probably damaging Het
Fam120a T C 13: 48,897,667 E754G probably damaging Het
Fam53b T C 7: 132,716,001 N304S probably benign Het
Fbxo41 T C 6: 85,483,919 E269G probably damaging Het
Fcrla T C 1: 170,922,390 T4A probably benign Het
Frmpd1 A T 4: 45,261,931 probably null Het
Gm9376 A G 14: 118,267,290 M45V probably benign Het
Gpr68 G A 12: 100,878,337 A316V probably benign Het
Hmgcl G A 4: 135,962,200 C323Y probably benign Het
Hnrnpu T C 1: 178,329,376 probably benign Het
Ier2 T A 8: 84,662,724 I10F probably damaging Het
Ip6k1 C T 9: 108,045,599 Q234* probably null Het
Llgl2 T C 11: 115,844,902 V108A probably benign Het
Lrfn3 T C 7: 30,360,380 N140S possibly damaging Het
Lrig1 T A 6: 94,611,449 H573L probably damaging Het
Lrrk2 T A 15: 91,749,878 W1393R probably damaging Het
Mrc1 T A 2: 14,244,189 Y179N probably damaging Het
Mtfr1 C T 3: 19,211,579 L93F probably damaging Het
Muc19 T C 15: 91,873,231 noncoding transcript Het
Ndst2 C T 14: 20,724,907 probably null Het
Nmd3 A T 3: 69,717,402 probably benign Het
Nsd3 A G 8: 25,682,577 Y784C probably damaging Het
Olfr1197 A T 2: 88,729,566 I11N probably damaging Het
Olfr1352 G A 10: 78,984,680 V297I probably benign Het
Papln A G 12: 83,774,889 Y297C probably damaging Het
Pdhx T C 2: 103,041,040 probably null Het
Pdpk1 T C 17: 24,111,045 T6A possibly damaging Het
Prcp T C 7: 92,919,160 W267R probably damaging Het
Prg2 T C 2: 84,982,023 S26P probably benign Het
Psg26 A T 7: 18,480,132 Y202N possibly damaging Het
Psrc1 T C 3: 108,380,523 probably benign Het
Rap1gds1 A T 3: 138,956,250 M366K probably damaging Het
Robo4 G T 9: 37,408,368 R527L probably benign Het
Sel1l3 G A 5: 53,200,434 T72M probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d A G 5: 12,448,038 T4A probably benign Het
Shroom1 A T 11: 53,467,117 probably benign Het
Slc25a19 T C 11: 115,616,671 probably null Het
Snx29 A C 16: 11,403,507 I266L probably damaging Het
Spo11 T C 2: 172,989,400 S255P probably damaging Het
Spock3 T C 8: 63,245,124 V167A possibly damaging Het
Tmc7 A G 7: 118,558,854 probably null Het
Tmtc4 A G 14: 122,933,331 V509A possibly damaging Het
Trim24 A G 6: 37,958,612 D880G probably benign Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr4 T A 4: 139,436,169 C2627S probably damaging Het
Unc5d A T 8: 28,715,747 M512K possibly damaging Het
Usp18 A G 6: 121,252,520 R33G possibly damaging Het
Utp23 T A 15: 51,882,173 V23D probably damaging Het
Wdr17 T A 8: 54,665,126 M512L possibly damaging Het
Wdr64 T A 1: 175,726,375 probably null Het
Zbtb6 T C 2: 37,429,239 T226A probably benign Het
Zc3hc1 T A 6: 30,375,988 H191L possibly damaging Het
Zdhhc4 C A 5: 143,324,933 C48F probably damaging Het
Zfp335 T A 2: 164,894,668 T1016S probably benign Het
Zfp583 A G 7: 6,325,474 Y39H probably damaging Het
Other mutations in Abi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Abi1 APN 2 22941930 missense possibly damaging 0.71
IGL01694:Abi1 APN 2 22960713 missense probably damaging 1.00
IGL01809:Abi1 APN 2 22946717 missense probably benign 0.00
IGL02189:Abi1 APN 2 23040064 start codon destroyed probably null 1.00
IGL03126:Abi1 APN 2 22953467 missense probably benign 0.12
IGL03213:Abi1 APN 2 22941959 missense probably damaging 1.00
IGL03325:Abi1 APN 2 22971228 missense probably damaging 1.00
R0421:Abi1 UTSW 2 22960827 missense probably damaging 1.00
R0505:Abi1 UTSW 2 22962504 splice site probably benign
R1265:Abi1 UTSW 2 22946722 missense possibly damaging 0.85
R1851:Abi1 UTSW 2 22950264 missense possibly damaging 0.78
R2975:Abi1 UTSW 2 22957087 missense probably damaging 0.99
R3416:Abi1 UTSW 2 23040002 missense probably damaging 1.00
R5277:Abi1 UTSW 2 22994648 missense probably damaging 1.00
R5945:Abi1 UTSW 2 23039965 missense probably damaging 1.00
R6785:Abi1 UTSW 2 22953467 missense probably benign 0.12
R7000:Abi1 UTSW 2 22942041 missense probably damaging 1.00
R7249:Abi1 UTSW 2 22957089 missense possibly damaging 0.82
R7565:Abi1 UTSW 2 22946584 missense probably benign 0.00
X0026:Abi1 UTSW 2 22971154 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGATATGGGTCAGTAATCATGCAG -3'
(R):5'- CATTTGCAGACTGTTCTTGGC -3'

Sequencing Primer
(F):5'- TATGGGTCAGTAATCATGCAGACAAG -3'
(R):5'- GGCATACTTATTTATGTTTGTGGTCC -3'
Posted On2016-06-06