Incidental Mutation 'R5000:Bdnf'
ID389794
Institutional Source Beutler Lab
Gene Symbol Bdnf
Ensembl Gene ENSMUSG00000048482
Gene Namebrain derived neurotrophic factor
Synonyms
MMRRC Submission 042594-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #R5000 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109674700-109727007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109723648 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 122 (N122K)
Ref Sequence ENSEMBL: ENSMUSP00000106671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053317] [ENSMUST00000111042] [ENSMUST00000111043] [ENSMUST00000111044] [ENSMUST00000111045] [ENSMUST00000111046] [ENSMUST00000111047] [ENSMUST00000111049] [ENSMUST00000111050] [ENSMUST00000111051] [ENSMUST00000176893]
Predicted Effect probably benign
Transcript: ENSMUST00000053317
AA Change: N90K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000057989
Gene: ENSMUSG00000048482
AA Change: N90K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
NGF 143 250 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111042
AA Change: N122K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106671
Gene: ENSMUSG00000048482
AA Change: N122K

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
NGF 175 282 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111043
AA Change: N82K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106672
Gene: ENSMUSG00000048482
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111044
AA Change: N82K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106673
Gene: ENSMUSG00000048482
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111045
AA Change: N82K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106674
Gene: ENSMUSG00000048482
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111046
AA Change: N82K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106675
Gene: ENSMUSG00000048482
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111047
AA Change: N82K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106676
Gene: ENSMUSG00000048482
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111049
AA Change: N82K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106678
Gene: ENSMUSG00000048482
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111050
AA Change: N82K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106679
Gene: ENSMUSG00000048482
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111051
AA Change: N82K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106680
Gene: ENSMUSG00000048482
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176893
AA Change: N82K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135762
Gene: ENSMUSG00000048482
AA Change: N82K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Meta Mutation Damage Score 0.1236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the nerve growth factor family. It is involved in the growth, differentiation and survival of specific types of developing neurons both in the central nervous system (CNS) and the peripheral nervous system. It is also involved in regulating synaptic plasticity in the CNS. Expression of a similar gene in human is reduced in both Alzheimer's and Huntington disease patients. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for targeted null alleles exhibit sensory neuron losses affecting coordination, balance, hearing, taste, and breathing, cerebellar abnormalities, increased sympathetic neuron number, and postnatal lethality. Carriers show mild defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,556,521 F11Y probably benign Het
Abca5 A G 11: 110,310,224 L450P probably damaging Het
Abi1 T A 2: 22,950,199 R357W probably damaging Het
Acot7 G A 4: 152,186,363 G55R probably benign Het
Aicda G A 6: 122,561,867 V14I probably damaging Het
Anxa4 G T 6: 86,765,784 probably benign Het
Apobr T A 7: 126,586,557 D413E possibly damaging Het
Ash1l T C 3: 89,058,634 Y2448H probably damaging Het
Atf7ip A G 6: 136,582,428 E749G probably damaging Het
Atp8b3 A T 10: 80,521,842 N1114K possibly damaging Het
Boc A T 16: 44,490,154 I801N probably damaging Het
Brap A T 5: 121,662,026 K37* probably null Het
Ccar1 C T 10: 62,751,005 E885K unknown Het
Ccdc103 A G 11: 102,884,106 N177S probably benign Het
Ccdc116 G A 16: 17,141,793 P344L possibly damaging Het
Cdca5 T C 19: 6,085,433 S28P possibly damaging Het
Ceacam20 T C 7: 19,965,528 I14T probably damaging Het
Chrnb1 A T 11: 69,787,032 V298E probably damaging Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Csnk1a1 T C 18: 61,578,769 F97L probably damaging Het
Dag1 A T 9: 108,208,017 S642T probably benign Het
Dedd2 A G 7: 25,203,643 V297A possibly damaging Het
Dhcr7 C T 7: 143,841,323 T189M possibly damaging Het
Dlgap1 T C 17: 70,766,058 S691P probably damaging Het
Dmgdh A C 13: 93,688,538 H123P probably damaging Het
Dnah6 C T 6: 73,144,815 V1395I probably benign Het
Dnah7a T C 1: 53,567,042 Y1273C probably damaging Het
Dnah7b T A 1: 46,099,503 L235* probably null Het
Elac2 T C 11: 64,985,553 F3L probably benign Het
Elovl7 A T 13: 108,274,381 K163N probably benign Het
Epg5 T C 18: 77,954,161 V413A probably benign Het
Espl1 T A 15: 102,298,551 L150Q probably damaging Het
F2rl3 T A 8: 72,762,679 L178Q probably damaging Het
Fam120a T C 13: 48,897,667 E754G probably damaging Het
Fam53b T C 7: 132,716,001 N304S probably benign Het
Fbxo41 T C 6: 85,483,919 E269G probably damaging Het
Fcrla T C 1: 170,922,390 T4A probably benign Het
Frmpd1 A T 4: 45,261,931 probably null Het
Gm9376 A G 14: 118,267,290 M45V probably benign Het
Gpr68 G A 12: 100,878,337 A316V probably benign Het
Hmgcl G A 4: 135,962,200 C323Y probably benign Het
Hnrnpu T C 1: 178,329,376 probably benign Het
Ier2 T A 8: 84,662,724 I10F probably damaging Het
Ip6k1 C T 9: 108,045,599 Q234* probably null Het
Llgl2 T C 11: 115,844,902 V108A probably benign Het
Lrfn3 T C 7: 30,360,380 N140S possibly damaging Het
Lrig1 T A 6: 94,611,449 H573L probably damaging Het
Lrrk2 T A 15: 91,749,878 W1393R probably damaging Het
Mrc1 T A 2: 14,244,189 Y179N probably damaging Het
Mtfr1 C T 3: 19,211,579 L93F probably damaging Het
Muc19 T C 15: 91,873,231 noncoding transcript Het
Ndst2 C T 14: 20,724,907 probably null Het
Nmd3 A T 3: 69,717,402 probably benign Het
Nsd3 A G 8: 25,682,577 Y784C probably damaging Het
Olfr1197 A T 2: 88,729,566 I11N probably damaging Het
Olfr1352 G A 10: 78,984,680 V297I probably benign Het
Papln A G 12: 83,774,889 Y297C probably damaging Het
Pdhx T C 2: 103,041,040 probably null Het
Pdpk1 T C 17: 24,111,045 T6A possibly damaging Het
Prcp T C 7: 92,919,160 W267R probably damaging Het
Prg2 T C 2: 84,982,023 S26P probably benign Het
Psg26 A T 7: 18,480,132 Y202N possibly damaging Het
Psrc1 T C 3: 108,380,523 probably benign Het
Rap1gds1 A T 3: 138,956,250 M366K probably damaging Het
Robo4 G T 9: 37,408,368 R527L probably benign Het
Sel1l3 G A 5: 53,200,434 T72M probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d A G 5: 12,448,038 T4A probably benign Het
Shroom1 A T 11: 53,467,117 probably benign Het
Slc25a19 T C 11: 115,616,671 probably null Het
Snx29 A C 16: 11,403,507 I266L probably damaging Het
Spo11 T C 2: 172,989,400 S255P probably damaging Het
Spock3 T C 8: 63,245,124 V167A possibly damaging Het
Tmc7 A G 7: 118,558,854 probably null Het
Tmtc4 A G 14: 122,933,331 V509A possibly damaging Het
Trim24 A G 6: 37,958,612 D880G probably benign Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr4 T A 4: 139,436,169 C2627S probably damaging Het
Unc5d A T 8: 28,715,747 M512K possibly damaging Het
Usp18 A G 6: 121,252,520 R33G possibly damaging Het
Utp23 T A 15: 51,882,173 V23D probably damaging Het
Wdr17 T A 8: 54,665,126 M512L possibly damaging Het
Wdr64 T A 1: 175,726,375 probably null Het
Zbtb6 T C 2: 37,429,239 T226A probably benign Het
Zc3hc1 T A 6: 30,375,988 H191L possibly damaging Het
Zdhhc4 C A 5: 143,324,933 C48F probably damaging Het
Zfp335 T A 2: 164,894,668 T1016S probably benign Het
Zfp583 A G 7: 6,325,474 Y39H probably damaging Het
Other mutations in Bdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Bdnf APN 2 109723547 missense probably benign 0.02
IGL01285:Bdnf APN 2 109723586 missense probably benign 0.02
IGL01595:Bdnf APN 2 109723928 nonsense probably null
IGL01737:Bdnf APN 2 109723755 missense probably damaging 1.00
IGL02450:Bdnf APN 2 109723604 missense possibly damaging 0.75
IGL02793:Bdnf APN 2 109723851 missense probably damaging 1.00
IGL02875:Bdnf APN 2 109723851 missense probably damaging 1.00
R0505:Bdnf UTSW 2 109675343 splice site probably null
R0626:Bdnf UTSW 2 109723538 missense probably benign 0.01
R0792:Bdnf UTSW 2 109724118 missense probably damaging 1.00
R1568:Bdnf UTSW 2 109723794 missense probably damaging 1.00
R2066:Bdnf UTSW 2 109723902 missense probably damaging 1.00
R4704:Bdnf UTSW 2 109723692 missense possibly damaging 0.89
R5259:Bdnf UTSW 2 109723982 missense probably benign 0.37
R5301:Bdnf UTSW 2 109723539 missense probably benign
R6344:Bdnf UTSW 2 109723677 missense probably benign 0.01
R7392:Bdnf UTSW 2 109723930 missense probably benign 0.01
X0028:Bdnf UTSW 2 109723883 missense possibly damaging 0.77
X0058:Bdnf UTSW 2 109723637 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCGGTTGCATGAAGGCG -3'
(R):5'- TACTGTCACACACGCTCAG -3'

Sequencing Primer
(F):5'- GCGCCCATGAAAGAAGTAAACGTC -3'
(R):5'- ACGCTCAGCTCCCCACG -3'
Posted On2016-06-06