Incidental Mutation 'R5000:Acot7'
ID389804
Institutional Source Beutler Lab
Gene Symbol Acot7
Ensembl Gene ENSMUSG00000028937
Gene Nameacyl-CoA thioesterase 7
Synonyms2410041A17Rik, Bach, AU014716
MMRRC Submission 042594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5000 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152178134-152271855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152186363 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 55 (G55R)
Ref Sequence ENSEMBL: ENSMUSP00000129121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030779] [ENSMUST00000075363] [ENSMUST00000167926]
Predicted Effect probably benign
Transcript: ENSMUST00000030779
AA Change: G52R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030779
Gene: ENSMUSG00000028937
AA Change: G52R

DomainStartEndE-ValueType
Pfam:4HBT 69 152 1e-16 PFAM
Pfam:4HBT 243 318 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075363
SMART Domains Protein: ENSMUSP00000074827
Gene: ENSMUSG00000028937

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:4HBT 67 150 1.2e-16 PFAM
Pfam:4HBT 241 316 5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124548
Predicted Effect probably benign
Transcript: ENSMUST00000167926
AA Change: G55R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129121
Gene: ENSMUSG00000028937
AA Change: G55R

DomainStartEndE-ValueType
Pfam:4HBT 72 155 2.3e-17 PFAM
Pfam:4HBT 246 320 1.2e-19 PFAM
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl coenzyme family. The encoded protein hydrolyzes the CoA thioester of palmitoyl-CoA and other long-chain fatty acids. Decreased expression of this gene may be associated with mesial temporal lobe epilepsy. Alternatively spliced transcript variants encoding distinct isoforms with different subcellular locations have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed allele activated in neurons exhibit abnormal glucose and lipid homeostasis, altered metabolism, increaased adiposity, decreased lean mass, progressive neurodegeneration, and neurological defects in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,556,521 F11Y probably benign Het
Abca5 A G 11: 110,310,224 L450P probably damaging Het
Abi1 T A 2: 22,950,199 R357W probably damaging Het
Aicda G A 6: 122,561,867 V14I probably damaging Het
Anxa4 G T 6: 86,765,784 probably benign Het
Apobr T A 7: 126,586,557 D413E possibly damaging Het
Ash1l T C 3: 89,058,634 Y2448H probably damaging Het
Atf7ip A G 6: 136,582,428 E749G probably damaging Het
Atp8b3 A T 10: 80,521,842 N1114K possibly damaging Het
Bdnf C A 2: 109,723,648 N122K probably benign Het
Boc A T 16: 44,490,154 I801N probably damaging Het
Brap A T 5: 121,662,026 K37* probably null Het
Ccar1 C T 10: 62,751,005 E885K unknown Het
Ccdc103 A G 11: 102,884,106 N177S probably benign Het
Ccdc116 G A 16: 17,141,793 P344L possibly damaging Het
Cdca5 T C 19: 6,085,433 S28P possibly damaging Het
Ceacam20 T C 7: 19,965,528 I14T probably damaging Het
Chrnb1 A T 11: 69,787,032 V298E probably damaging Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Csnk1a1 T C 18: 61,578,769 F97L probably damaging Het
Dag1 A T 9: 108,208,017 S642T probably benign Het
Dedd2 A G 7: 25,203,643 V297A possibly damaging Het
Dhcr7 C T 7: 143,841,323 T189M possibly damaging Het
Dlgap1 T C 17: 70,766,058 S691P probably damaging Het
Dmgdh A C 13: 93,688,538 H123P probably damaging Het
Dnah6 C T 6: 73,144,815 V1395I probably benign Het
Dnah7a T C 1: 53,567,042 Y1273C probably damaging Het
Dnah7b T A 1: 46,099,503 L235* probably null Het
Elac2 T C 11: 64,985,553 F3L probably benign Het
Elovl7 A T 13: 108,274,381 K163N probably benign Het
Epg5 T C 18: 77,954,161 V413A probably benign Het
Espl1 T A 15: 102,298,551 L150Q probably damaging Het
F2rl3 T A 8: 72,762,679 L178Q probably damaging Het
Fam120a T C 13: 48,897,667 E754G probably damaging Het
Fam53b T C 7: 132,716,001 N304S probably benign Het
Fbxo41 T C 6: 85,483,919 E269G probably damaging Het
Fcrla T C 1: 170,922,390 T4A probably benign Het
Frmpd1 A T 4: 45,261,931 probably null Het
Gm9376 A G 14: 118,267,290 M45V probably benign Het
Gpr68 G A 12: 100,878,337 A316V probably benign Het
Hmgcl G A 4: 135,962,200 C323Y probably benign Het
Hnrnpu T C 1: 178,329,376 probably benign Het
Ier2 T A 8: 84,662,724 I10F probably damaging Het
Ip6k1 C T 9: 108,045,599 Q234* probably null Het
Llgl2 T C 11: 115,844,902 V108A probably benign Het
Lrfn3 T C 7: 30,360,380 N140S possibly damaging Het
Lrig1 T A 6: 94,611,449 H573L probably damaging Het
Lrrk2 T A 15: 91,749,878 W1393R probably damaging Het
Mrc1 T A 2: 14,244,189 Y179N probably damaging Het
Mtfr1 C T 3: 19,211,579 L93F probably damaging Het
Muc19 T C 15: 91,873,231 noncoding transcript Het
Ndst2 C T 14: 20,724,907 probably null Het
Nmd3 A T 3: 69,717,402 probably benign Het
Nsd3 A G 8: 25,682,577 Y784C probably damaging Het
Olfr1197 A T 2: 88,729,566 I11N probably damaging Het
Olfr1352 G A 10: 78,984,680 V297I probably benign Het
Papln A G 12: 83,774,889 Y297C probably damaging Het
Pdhx T C 2: 103,041,040 probably null Het
Pdpk1 T C 17: 24,111,045 T6A possibly damaging Het
Prcp T C 7: 92,919,160 W267R probably damaging Het
Prg2 T C 2: 84,982,023 S26P probably benign Het
Psg26 A T 7: 18,480,132 Y202N possibly damaging Het
Psrc1 T C 3: 108,380,523 probably benign Het
Rap1gds1 A T 3: 138,956,250 M366K probably damaging Het
Robo4 G T 9: 37,408,368 R527L probably benign Het
Sel1l3 G A 5: 53,200,434 T72M probably damaging Het
Selenoo G A 15: 89,094,184 R270H probably damaging Het
Sema3d A G 5: 12,448,038 T4A probably benign Het
Shroom1 A T 11: 53,467,117 probably benign Het
Slc25a19 T C 11: 115,616,671 probably null Het
Snx29 A C 16: 11,403,507 I266L probably damaging Het
Spo11 T C 2: 172,989,400 S255P probably damaging Het
Spock3 T C 8: 63,245,124 V167A possibly damaging Het
Tmc7 A G 7: 118,558,854 probably null Het
Tmtc4 A G 14: 122,933,331 V509A possibly damaging Het
Trim24 A G 6: 37,958,612 D880G probably benign Het
Ube2j2 G A 4: 155,946,384 M1I probably null Het
Ubr4 T A 4: 139,436,169 C2627S probably damaging Het
Unc5d A T 8: 28,715,747 M512K possibly damaging Het
Usp18 A G 6: 121,252,520 R33G possibly damaging Het
Utp23 T A 15: 51,882,173 V23D probably damaging Het
Wdr17 T A 8: 54,665,126 M512L possibly damaging Het
Wdr64 T A 1: 175,726,375 probably null Het
Zbtb6 T C 2: 37,429,239 T226A probably benign Het
Zc3hc1 T A 6: 30,375,988 H191L possibly damaging Het
Zdhhc4 C A 5: 143,324,933 C48F probably damaging Het
Zfp335 T A 2: 164,894,668 T1016S probably benign Het
Zfp583 A G 7: 6,325,474 Y39H probably damaging Het
Other mutations in Acot7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Acot7 APN 4 152260896 missense probably benign 0.39
IGL01758:Acot7 APN 4 152217793 missense probably damaging 0.96
IGL01991:Acot7 APN 4 152223079 missense possibly damaging 0.84
R1329:Acot7 UTSW 4 152229784 nonsense probably null
R1605:Acot7 UTSW 4 152206828 missense possibly damaging 0.46
R1625:Acot7 UTSW 4 152186291 missense probably benign 0.01
R1739:Acot7 UTSW 4 152260912 missense probably damaging 1.00
R4169:Acot7 UTSW 4 152217793 missense probably damaging 0.96
R4473:Acot7 UTSW 4 152206856 missense probably damaging 1.00
R4857:Acot7 UTSW 4 152237754 missense possibly damaging 0.76
R4884:Acot7 UTSW 4 152186207 intron probably benign
R6123:Acot7 UTSW 4 152199945 missense probably benign
R6633:Acot7 UTSW 4 152178259 missense probably benign
R6938:Acot7 UTSW 4 152217894 critical splice donor site probably null
R7025:Acot7 UTSW 4 152178189 missense unknown
Predicted Primers PCR Primer
(F):5'- AGATATTGGCCGGAAGCTGTC -3'
(R):5'- TCCATCTAAGACAATGCAGCTC -3'

Sequencing Primer
(F):5'- TCTGGTAGCTAAGCCTGGC -3'
(R):5'- TCTAAGACAATGCAGCTCACCCG -3'
Posted On2016-06-06