Incidental Mutation 'R0436:Arl8a'
List |< first << previous [record 95 of 1308] next >> last >|
ID38985
Institutional Source Beutler Lab
Gene Symbol Arl8a
Ensembl Gene ENSMUSG00000026426
Gene NameADP-ribosylation factor-like 8A
Synonyms1110033P22Rik, Arl10b
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R0436 (G1)
Quality Score127
Status Validated
Chromosome1
Chromosomal Location135146824-135156269 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to A at 135146980 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000027684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027684] [ENSMUST00000049449] [ENSMUST00000167080] [ENSMUST00000187985]
Predicted Effect probably null
Transcript: ENSMUST00000027684
AA Change: M1I

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027684
Gene: ENSMUSG00000026426
AA Change: M1I

DomainStartEndE-ValueType
ARF 1 185 2.25e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049449
SMART Domains Protein: ENSMUSP00000045803
Gene: ENSMUSG00000031506

DomainStartEndE-ValueType
low complexity region 25 34 N/A INTRINSIC
PTPc 96 351 2.3e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125774
SMART Domains Protein: ENSMUSP00000121545
Gene: ENSMUSG00000026426

DomainStartEndE-ValueType
Pfam:Roc 16 113 1e-12 PFAM
Pfam:Ras 18 162 4.2e-16 PFAM
Pfam:Arf 19 160 6.6e-41 PFAM
Pfam:Gtr1_RagA 26 155 3.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157096
Predicted Effect probably benign
Transcript: ENSMUST00000167080
SMART Domains Protein: ENSMUSP00000129474
Gene: ENSMUSG00000031506

DomainStartEndE-ValueType
low complexity region 25 34 N/A INTRINSIC
PTPc 96 351 2.3e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187985
SMART Domains Protein: ENSMUSP00000141133
Gene: ENSMUSG00000031506

DomainStartEndE-ValueType
low complexity region 25 34 N/A INTRINSIC
PTPc 96 351 2.3e-117 SMART
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Alx4 A T 2: 93,668,357 K145* probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in Arl8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Arl8a APN 1 135152868 critical splice donor site probably null
R1639:Arl8a UTSW 1 135152823 nonsense probably null
R2393:Arl8a UTSW 1 135152866 missense probably damaging 1.00
R2842:Arl8a UTSW 1 135155251 missense probably damaging 0.98
R3873:Arl8a UTSW 1 135152872 splice site probably null
R4764:Arl8a UTSW 1 135147099 missense probably benign 0.04
R5736:Arl8a UTSW 1 135154720 missense probably benign
R6007:Arl8a UTSW 1 135152868 critical splice donor site probably null
R6989:Arl8a UTSW 1 135146997 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAAGCCAGAAAGCGGTGCAG -3'
(R):5'- AAGAACCGTGCTAGGCCCTAAGTG -3'

Sequencing Primer
(F):5'- AATTACAGCTTTCTCCGCAAG -3'
(R):5'- CCCTAAGTGCCCGGAGC -3'
Posted On2013-05-23