Incidental Mutation 'R5001:Adcy3'
ID389945
Institutional Source Beutler Lab
Gene Symbol Adcy3
Ensembl Gene ENSMUSG00000020654
Gene Nameadenylate cyclase 3
SynonymsAC3
MMRRC Submission 042595-MU
Accession Numbers

Ncbi RefSeq: NM_138305.3, NM_001159536.1, NM_001159537.1; MGI:99675

Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R5001 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4133103-4213525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4198434 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 499 (V499M)
Ref Sequence ENSEMBL: ENSMUSP00000115644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020984] [ENSMUST00000111169] [ENSMUST00000124505] [ENSMUST00000127756] [ENSMUST00000152065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020984
AA Change: V499M

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020984
Gene: ENSMUSG00000020654
AA Change: V499M

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111169
SMART Domains Protein: ENSMUSP00000106799
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 118 195 2.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124505
AA Change: V499M

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122073
Gene: ENSMUSG00000020654
AA Change: V499M

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127110
Predicted Effect possibly damaging
Transcript: ENSMUST00000127756
AA Change: V499M

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115406
Gene: ENSMUSG00000020654
AA Change: V499M

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150944
Predicted Effect possibly damaging
Transcript: ENSMUST00000152065
AA Change: V499M

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115644
Gene: ENSMUSG00000020654
AA Change: V499M

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152792
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype Strain: 2661086; 3604495
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for one mutation of this gene display impaired olfaction and disorganization of glomeruli in the main olfactory bulb. Mutant animals also appear to be sterile as homozygous matings failed to produce litters. Mice with another mutant allele fail to survive beyond weaning. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T C 11: 53,404,357 S795P probably damaging Het
Ank G A 15: 27,562,733 V176I probably damaging Het
Ankfn1 A G 11: 89,441,442 I446T possibly damaging Het
Arhgap33 C A 7: 30,533,016 S32I possibly damaging Het
Ascc3 T A 10: 50,823,648 Y1856N probably damaging Het
Atf3 T C 1: 191,177,275 T66A probably benign Het
Atf7ip T C 6: 136,561,388 C548R probably damaging Het
Bag6 A G 17: 35,145,176 T841A probably damaging Het
Bbof1 A T 12: 84,426,856 Q320L possibly damaging Het
Bmp2k A T 5: 97,053,142 Q307L probably damaging Het
Btaf1 T A 19: 36,986,652 N874K possibly damaging Het
Calr4 G A 4: 109,238,982 probably null Het
Camk1d T C 2: 5,313,101 I248V possibly damaging Het
Ccdc130 G A 8: 84,258,675 P322S probably benign Het
Ccdc177 G A 12: 80,757,386 R705C unknown Het
Cdk18 C T 1: 132,118,849 probably null Het
Cers4 A G 8: 4,515,565 S4G probably benign Het
Cfap54 A G 10: 92,964,534 V1604A probably benign Het
Chd8 C T 14: 52,203,915 G907S probably benign Het
Cnksr3 G A 10: 7,126,746 Q149* probably null Het
Cntd1 T C 11: 101,285,731 V218A possibly damaging Het
Cog7 A T 7: 121,949,886 V384E probably damaging Het
Col5a2 A G 1: 45,502,898 V6A unknown Het
Col7a1 T C 9: 108,965,078 probably null Het
Cpsf6 T A 10: 117,367,961 I29L possibly damaging Het
Cyp3a13 T C 5: 137,898,916 T379A probably benign Het
Ddx46 T C 13: 55,652,919 S296P probably damaging Het
Dmbt1 A G 7: 131,050,012 D328G probably damaging Het
Dnah8 T G 17: 30,787,185 L3692W probably damaging Het
Dnmt3l A C 10: 78,059,731 S368R probably null Het
Egfr A G 11: 16,904,434 K869E probably damaging Het
Ehd1 G A 19: 6,297,694 M359I probably benign Het
F5 A T 1: 164,195,570 T1566S probably benign Het
Fam207a A G 10: 77,490,016 V154A probably benign Het
Flrt2 T C 12: 95,778,951 I21T probably benign Het
Galnt1 T A 18: 24,271,755 I383K probably benign Het
Ghdc G T 11: 100,766,834 A523D probably damaging Het
Gm24022 A G 12: 113,429,779 probably benign Het
Golga3 T C 5: 110,205,777 S934P probably damaging Het
Gpr135 T A 12: 72,070,508 T162S probably benign Het
Gucd1 G A 10: 75,517,202 probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ick T C 9: 78,131,519 S17P probably damaging Het
Igkv6-15 T C 6: 70,406,649 Y56C probably damaging Het
Il22ra1 A T 4: 135,733,104 Y57F probably damaging Het
Irak4 A G 15: 94,558,273 E247G possibly damaging Het
Kank3 T C 17: 33,821,772 V13A possibly damaging Het
Klhl1 A T 14: 96,136,610 S667T probably damaging Het
Klhl6 T G 16: 19,946,991 *620C probably null Het
Lct A G 1: 128,308,241 L343P probably damaging Het
Lgr6 G T 1: 134,990,632 P264T probably benign Het
Lilrb4a T A 10: 51,491,420 probably null Het
Lin7a G T 10: 107,382,669 G25* probably null Het
Lmnb2 G A 10: 80,918,112 T36M probably damaging Het
Manba T C 3: 135,567,630 F775S probably benign Het
March6 A G 15: 31,465,322 V812A probably damaging Het
Megf6 T A 4: 154,268,060 L1292H probably damaging Het
Myo18b T G 5: 112,761,340 Q1979P probably damaging Het
Myoz1 T C 14: 20,653,701 M59V probably damaging Het
Naa35 T C 13: 59,625,531 I100T possibly damaging Het
Nox4 A T 7: 87,360,803 Y404F probably damaging Het
Ntn1 T C 11: 68,260,532 Y441C probably damaging Het
Olfr1329 C A 4: 118,917,243 V75F probably damaging Het
Olfr351 T C 2: 36,860,070 T93A probably benign Het
Olfr984 G A 9: 40,101,227 H88Y probably benign Het
Onecut3 A G 10: 80,495,320 T105A unknown Het
Pabpc1l A G 2: 164,042,518 S392G probably benign Het
Pan3 T A 5: 147,526,682 probably null Het
Pcdha4 G A 18: 36,954,948 S728N probably benign Het
Pds5a T C 5: 65,696,785 D38G probably damaging Het
Pgm2l1 A G 7: 100,272,376 I605V probably benign Het
Phip T C 9: 82,896,019 probably null Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Ppig T A 2: 69,741,486 V183D unknown Het
Ppp2r2a A T 14: 67,022,308 L313* probably null Het
Ppp4c A G 7: 126,787,537 F126S probably damaging Het
Ptger2 C A 14: 44,989,367 R135S probably damaging Het
Rab11fip5 T A 6: 85,347,806 E506D probably damaging Het
Rdh12 G A 12: 79,212,742 G133R probably damaging Het
Rims2 A T 15: 39,452,428 D610V probably benign Het
Saa1 T A 7: 46,740,708 Y122F probably damaging Het
Sept10 A T 10: 59,176,989 V269E probably damaging Het
Serpina3n T A 12: 104,408,739 D23E probably benign Het
Serpinb11 A G 1: 107,376,868 K188E possibly damaging Het
Slc18a3 C T 14: 32,463,779 V216M possibly damaging Het
Slc19a3 G T 1: 83,022,620 N225K probably benign Het
Slc4a1 T A 11: 102,351,503 I797F probably benign Het
Spic A G 10: 88,675,899 M165T possibly damaging Het
Timm44 A T 8: 4,275,886 M1K probably null Het
Tmc6 A G 11: 117,770,784 L572P probably benign Het
Tnc G A 4: 63,984,489 T1517I probably damaging Het
Tnc G A 4: 64,000,062 T1204M probably benign Het
Trip11 A T 12: 101,884,910 L680* probably null Het
Trps1 T A 15: 50,661,307 M887L possibly damaging Het
Tulp3 A C 6: 128,325,068 V330G probably damaging Het
Upf1 A G 8: 70,334,700 S835P probably damaging Het
Wdr64 A G 1: 175,792,959 probably null Het
Zbtb40 A G 4: 136,996,150 L643P probably damaging Het
Zc3h18 A T 8: 122,383,520 D36V probably damaging Het
Other mutations in Adcy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adcy3 APN 12 4194357 missense probably damaging 1.00
IGL00985:Adcy3 APN 12 4134600 missense probably damaging 0.98
IGL01735:Adcy3 APN 12 4201213 missense probably benign 0.00
IGL02097:Adcy3 APN 12 4212118 missense probably damaging 1.00
IGL02102:Adcy3 APN 12 4134699 missense probably damaging 1.00
IGL02103:Adcy3 APN 12 4134390 missense possibly damaging 0.69
IGL02155:Adcy3 APN 12 4212142 nonsense probably null
IGL02376:Adcy3 APN 12 4201031 missense possibly damaging 0.77
IGL02411:Adcy3 APN 12 4209407 unclassified probably null
IGL02465:Adcy3 APN 12 4200906 missense probably benign 0.10
IGL02819:Adcy3 APN 12 4206986 splice site probably benign
magnificent_frigatebird UTSW 12 4194324 missense
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0918:Adcy3 UTSW 12 4198360 missense probably benign 0.05
R1480:Adcy3 UTSW 12 4212171 missense probably damaging 1.00
R1736:Adcy3 UTSW 12 4200998 missense possibly damaging 0.87
R1885:Adcy3 UTSW 12 4134951 missense probably damaging 1.00
R1897:Adcy3 UTSW 12 4173450 splice site probably benign
R1951:Adcy3 UTSW 12 4208624 missense probably benign 0.29
R2083:Adcy3 UTSW 12 4173512 missense probably damaging 1.00
R2417:Adcy3 UTSW 12 4208627 missense probably benign 0.05
R4379:Adcy3 UTSW 12 4134558 missense probably damaging 1.00
R4785:Adcy3 UTSW 12 4206542 missense probably benign 0.00
R4960:Adcy3 UTSW 12 4134896 missense probably benign 0.11
R5166:Adcy3 UTSW 12 4134438 missense probably damaging 1.00
R5375:Adcy3 UTSW 12 4210870 missense probably damaging 1.00
R5416:Adcy3 UTSW 12 4209308 missense probably damaging 1.00
R5998:Adcy3 UTSW 12 4198348 missense probably damaging 1.00
R6248:Adcy3 UTSW 12 4208662 critical splice donor site probably null
R6490:Adcy3 UTSW 12 4212150 missense probably damaging 1.00
R6566:Adcy3 UTSW 12 4194324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCTCAGGGTTTCTCATTGC -3'
(R):5'- CAGCAAGCCTTCCTAGGATCTC -3'

Sequencing Primer
(F):5'- GGTTTCTCATTGCGCCGCAG -3'
(R):5'- GCTTATATAGCCTAAGCAGATCCTG -3'
Posted On2016-06-06