Incidental Mutation 'R5004:Fbln5'
ID390091
Institutional Source Beutler Lab
Gene Symbol Fbln5
Ensembl Gene ENSMUSG00000021186
Gene Namefibulin 5
SynonymsEVEC
MMRRC Submission 042597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R5004 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101746565-101819055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101760821 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 303 (N303I)
Ref Sequence ENSEMBL: ENSMUSP00000152680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021603] [ENSMUST00000222587]
Predicted Effect probably damaging
Transcript: ENSMUST00000021603
AA Change: N290I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021603
Gene: ENSMUSG00000021186
AA Change: N290I

DomainStartEndE-ValueType
EGF_like 42 86 4.71e-1 SMART
EGF_CA 127 167 4.81e-8 SMART
EGF_CA 168 206 2.31e-10 SMART
EGF_CA 207 246 5.31e-10 SMART
EGF_CA 247 287 2.22e-12 SMART
EGF_like 288 333 8.14e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221373
Predicted Effect probably damaging
Transcript: ENSMUST00000222587
AA Change: N303I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted, extracellular matrix protein containing an Arg-Gly-Asp (RGD) motif and calcium-binding EGF-like domains. It promotes adhesion of endothelial cells through interaction of integrins and the RGD motif. It is prominently expressed in developing arteries but less so in adult vessels. However, its expression is reinduced in balloon-injured vessels and atherosclerotic lesions, notably in intimal vascular smooth muscle cells and endothelial cells. Therefore, the protein encoded by this gene may play a role in vascular development and remodeling. Defects in this gene are a cause of autosomal dominant cutis laxa, autosomal recessive cutis laxa type I (CL type I), and age-related macular degeneration type 3 (ARMD3). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus impairs elastic fiber development. Mutant mice exhibit loose skin, lung abnormalities leading to emphysema, and cardiovascular defects affecting the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A C 8: 13,555,927 D189E possibly damaging Het
2610528A11Rik A T 14: 37,102,665 C60S probably damaging Het
Abca5 C T 11: 110,279,376 E1298K probably damaging Het
Actg1 C A 11: 120,348,160 probably benign Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alox12e A G 11: 70,321,504 V116A probably benign Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Arfgap3 T A 15: 83,310,296 S391C possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cars2 C T 8: 11,518,956 probably null Het
Cav3 A G 6: 112,459,924 K38R probably damaging Het
Ccdc159 G A 9: 21,932,945 R101H probably damaging Het
Cops7b A G 1: 86,587,410 probably benign Het
Cyp4a12b C T 4: 115,438,113 T472I probably benign Het
Cyp4a32 T C 4: 115,601,041 S23P probably damaging Het
Cyp4f13 T G 17: 32,925,786 I275L probably benign Het
Dlgap1 T A 17: 70,718,227 probably null Het
Dnajc12 A T 10: 63,386,707 I4L probably benign Het
Ephb2 T A 4: 136,659,699 D739V possibly damaging Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fdxr T C 11: 115,269,573 E352G probably benign Het
Fhad1 T G 4: 142,002,599 probably null Het
Fhod1 C T 8: 105,336,945 probably benign Het
Fndc7 G A 3: 108,883,473 T79M probably damaging Het
Fry A G 5: 150,433,604 Q1872R probably benign Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm13088 T C 4: 143,654,136 Q439R probably benign Het
Hacl1 C A 14: 31,619,039 C346F probably benign Het
Hectd4 C A 5: 121,328,199 probably null Het
Hectd4 C T 5: 121,329,565 P2526S possibly damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Itih4 T G 14: 30,892,672 L497R probably damaging Het
Kcnh3 A T 15: 99,226,502 K91* probably null Het
Kiz C G 2: 146,969,979 D669E possibly damaging Het
Klhl30 T A 1: 91,359,324 probably null Het
Kndc1 C A 7: 139,932,879 C1514* probably null Het
Lipo2 A G 19: 33,721,676 probably null Het
Macf1 T C 4: 123,385,475 D5921G probably damaging Het
Mau2 A G 8: 70,025,887 Y394H probably damaging Het
Mctp1 T A 13: 76,641,804 S50R possibly damaging Het
Mllt10 T C 2: 18,170,268 Y3H probably damaging Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mrgpra4 A C 7: 47,981,787 L22R probably benign Het
Msln T G 17: 25,754,219 M1L possibly damaging Het
Myh15 T A 16: 49,132,048 I827N probably damaging Het
Myh7 T C 14: 54,971,683 D1866G probably damaging Het
Myo5b T G 18: 74,744,773 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nup210l A T 3: 90,180,165 R1082* probably null Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Olfr487 T A 7: 108,212,116 K138* probably null Het
Olfr860 T C 9: 19,846,102 I172M probably benign Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pkd2l1 G T 19: 44,149,577 A690E probably benign Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prrc2a T A 17: 35,149,998 N2021Y probably benign Het
Prss3 T C 6: 41,373,902 Y218C probably damaging Het
Psg20 T C 7: 18,680,912 T350A probably damaging Het
Ptprg A T 14: 12,220,667 I1235F probably damaging Het
Ptprk T A 10: 28,586,063 D1181E possibly damaging Het
Rcc2 T A 4: 140,717,666 S415T possibly damaging Het
Ripor1 CAA CA 8: 105,618,820 probably null Het
Rnf31 T C 14: 55,592,182 L68P probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Rubcnl C T 14: 75,032,177 Q92* probably null Het
Scfd1 A G 12: 51,444,994 R580G probably benign Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sema4b C A 7: 80,216,345 T154N probably benign Het
Sept14 T A 5: 129,692,976 I219F possibly damaging Het
Serpinb9c A T 13: 33,150,355 S235T probably benign Het
Setd4 G T 16: 93,591,245 H118N probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Soat2 T A 15: 102,161,111 H402Q probably damaging Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spef2 T G 15: 9,578,327 S1704R probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Steap1 G T 5: 5,742,829 Y27* probably null Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tdpoz1 T A 3: 93,671,133 T115S probably benign Het
Tet2 A T 3: 133,487,379 H431Q possibly damaging Het
Tnrc6c T G 11: 117,721,046 V170G probably benign Het
Tom1 T C 8: 75,052,002 L99P probably damaging Het
Trim11 C A 11: 58,981,338 probably benign Het
Trio T C 15: 27,755,178 K955R probably damaging Het
Tubd1 C T 11: 86,561,320 T371I probably damaging Het
Usp17lb C T 7: 104,841,677 M13I probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Usp34 A G 11: 23,464,586 Y2843C probably damaging Het
Utp20 A T 10: 88,748,273 I2674N probably damaging Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r51 T A 7: 10,088,005 E584D probably benign Het
Zbtb22 G T 17: 33,917,243 A121S probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zkscan2 C T 7: 123,490,044 V335M probably damaging Het
Other mutations in Fbln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Fbln5 APN 12 101809916 missense probably damaging 0.98
IGL01357:Fbln5 APN 12 101750887 missense probably damaging 1.00
IGL01860:Fbln5 APN 12 101809869 missense probably damaging 1.00
IGL02567:Fbln5 APN 12 101761800 critical splice donor site probably null
R0368:Fbln5 UTSW 12 101809714 critical splice donor site probably null
R1080:Fbln5 UTSW 12 101750872 missense possibly damaging 0.90
R1606:Fbln5 UTSW 12 101765198 missense probably benign 0.04
R2107:Fbln5 UTSW 12 101771269 missense probably damaging 1.00
R2138:Fbln5 UTSW 12 101761920 missense probably benign 0.32
R3694:Fbln5 UTSW 12 101765252 missense probably benign 0.00
R3918:Fbln5 UTSW 12 101750791 missense probably damaging 1.00
R4166:Fbln5 UTSW 12 101757359 missense probably damaging 1.00
R4626:Fbln5 UTSW 12 101760827 missense probably damaging 1.00
R5264:Fbln5 UTSW 12 101757444 missense possibly damaging 0.94
R5364:Fbln5 UTSW 12 101771364 missense probably damaging 0.98
R5767:Fbln5 UTSW 12 101765209 missense probably damaging 0.97
R5889:Fbln5 UTSW 12 101765226 missense probably damaging 1.00
R5914:Fbln5 UTSW 12 101760743 missense possibly damaging 0.78
R6427:Fbln5 UTSW 12 101761822 missense possibly damaging 0.84
R7079:Fbln5 UTSW 12 101757408 missense probably damaging 1.00
R7343:Fbln5 UTSW 12 101760816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGACAGTCTCCTGAGCCAG -3'
(R):5'- GGTGACAGACATCAGAAACGTC -3'

Sequencing Primer
(F):5'- TGAGCCAGGTCCCCATTC -3'
(R):5'- CACTCAAATTACTATGAACGTGGGC -3'
Posted On2016-06-06