Incidental Mutation 'R5004:Myh15'
ID390113
Institutional Source Beutler Lab
Gene Symbol Myh15
Ensembl Gene ENSMUSG00000092009
Gene Namemyosin, heavy chain 15
SynonymsEG667772
MMRRC Submission 042597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5004 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location49057486-49199104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49132048 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 827 (I827N)
Ref Sequence ENSEMBL: ENSMUSP00000127539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168680]
Predicted Effect probably damaging
Transcript: ENSMUST00000168680
AA Change: I827N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127539
Gene: ENSMUSG00000092009
AA Change: I827N

DomainStartEndE-ValueType
Pfam:Myosin_N 30 70 5.2e-12 PFAM
MYSc 76 770 N/A SMART
Pfam:Myosin_tail_1 836 1915 9.5e-118 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A C 8: 13,555,927 D189E possibly damaging Het
2610528A11Rik A T 14: 37,102,665 C60S probably damaging Het
Abca5 C T 11: 110,279,376 E1298K probably damaging Het
Actg1 C A 11: 120,348,160 probably benign Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alox12e A G 11: 70,321,504 V116A probably benign Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Arfgap3 T A 15: 83,310,296 S391C possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cars2 C T 8: 11,518,956 probably null Het
Cav3 A G 6: 112,459,924 K38R probably damaging Het
Ccdc159 G A 9: 21,932,945 R101H probably damaging Het
Cops7b A G 1: 86,587,410 probably benign Het
Cyp4a12b C T 4: 115,438,113 T472I probably benign Het
Cyp4a32 T C 4: 115,601,041 S23P probably damaging Het
Cyp4f13 T G 17: 32,925,786 I275L probably benign Het
Dlgap1 T A 17: 70,718,227 probably null Het
Dnajc12 A T 10: 63,386,707 I4L probably benign Het
Ephb2 T A 4: 136,659,699 D739V possibly damaging Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fbln5 T A 12: 101,760,821 N303I probably damaging Het
Fdxr T C 11: 115,269,573 E352G probably benign Het
Fhad1 T G 4: 142,002,599 probably null Het
Fhod1 C T 8: 105,336,945 probably benign Het
Fndc7 G A 3: 108,883,473 T79M probably damaging Het
Fry A G 5: 150,433,604 Q1872R probably benign Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm13088 T C 4: 143,654,136 Q439R probably benign Het
Hacl1 C A 14: 31,619,039 C346F probably benign Het
Hectd4 C A 5: 121,328,199 probably null Het
Hectd4 C T 5: 121,329,565 P2526S possibly damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Itih4 T G 14: 30,892,672 L497R probably damaging Het
Kcnh3 A T 15: 99,226,502 K91* probably null Het
Kiz C G 2: 146,969,979 D669E possibly damaging Het
Klhl30 T A 1: 91,359,324 probably null Het
Kndc1 C A 7: 139,932,879 C1514* probably null Het
Lipo2 A G 19: 33,721,676 probably null Het
Macf1 T C 4: 123,385,475 D5921G probably damaging Het
Mau2 A G 8: 70,025,887 Y394H probably damaging Het
Mctp1 T A 13: 76,641,804 S50R possibly damaging Het
Mllt10 T C 2: 18,170,268 Y3H probably damaging Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mrgpra4 A C 7: 47,981,787 L22R probably benign Het
Msln T G 17: 25,754,219 M1L possibly damaging Het
Myh7 T C 14: 54,971,683 D1866G probably damaging Het
Myo5b T G 18: 74,744,773 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nup210l A T 3: 90,180,165 R1082* probably null Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Olfr487 T A 7: 108,212,116 K138* probably null Het
Olfr860 T C 9: 19,846,102 I172M probably benign Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pkd2l1 G T 19: 44,149,577 A690E probably benign Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prrc2a T A 17: 35,149,998 N2021Y probably benign Het
Prss3 T C 6: 41,373,902 Y218C probably damaging Het
Psg20 T C 7: 18,680,912 T350A probably damaging Het
Ptprg A T 14: 12,220,667 I1235F probably damaging Het
Ptprk T A 10: 28,586,063 D1181E possibly damaging Het
Rcc2 T A 4: 140,717,666 S415T possibly damaging Het
Ripor1 CAA CA 8: 105,618,820 probably null Het
Rnf31 T C 14: 55,592,182 L68P probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Rubcnl C T 14: 75,032,177 Q92* probably null Het
Scfd1 A G 12: 51,444,994 R580G probably benign Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sema4b C A 7: 80,216,345 T154N probably benign Het
Sept14 T A 5: 129,692,976 I219F possibly damaging Het
Serpinb9c A T 13: 33,150,355 S235T probably benign Het
Setd4 G T 16: 93,591,245 H118N probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Soat2 T A 15: 102,161,111 H402Q probably damaging Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spef2 T G 15: 9,578,327 S1704R probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Steap1 G T 5: 5,742,829 Y27* probably null Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tdpoz1 T A 3: 93,671,133 T115S probably benign Het
Tet2 A T 3: 133,487,379 H431Q possibly damaging Het
Tnrc6c T G 11: 117,721,046 V170G probably benign Het
Tom1 T C 8: 75,052,002 L99P probably damaging Het
Trim11 C A 11: 58,981,338 probably benign Het
Trio T C 15: 27,755,178 K955R probably damaging Het
Tubd1 C T 11: 86,561,320 T371I probably damaging Het
Usp17lb C T 7: 104,841,677 M13I probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Usp34 A G 11: 23,464,586 Y2843C probably damaging Het
Utp20 A T 10: 88,748,273 I2674N probably damaging Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r51 T A 7: 10,088,005 E584D probably benign Het
Zbtb22 G T 17: 33,917,243 A121S probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zkscan2 C T 7: 123,490,044 V335M probably damaging Het
Other mutations in Myh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Myh15 APN 16 49165813 missense probably damaging 0.98
IGL01095:Myh15 APN 16 49132015 missense probably damaging 1.00
IGL01343:Myh15 APN 16 49155677 missense probably benign 0.09
IGL01474:Myh15 APN 16 49132098 missense probably damaging 1.00
IGL01572:Myh15 APN 16 49100222 missense possibly damaging 0.55
IGL01595:Myh15 APN 16 49172949 missense probably damaging 1.00
IGL01632:Myh15 APN 16 49061511 missense probably benign 0.00
IGL01638:Myh15 APN 16 49069480 missense probably damaging 1.00
IGL01667:Myh15 APN 16 49195579 missense probably benign 0.20
IGL01715:Myh15 APN 16 49057484 unclassified probably benign
IGL01833:Myh15 APN 16 49114058 missense probably damaging 1.00
IGL02004:Myh15 APN 16 49110529 splice site probably benign
IGL02033:Myh15 APN 16 49145344 missense probably benign 0.05
IGL02148:Myh15 APN 16 49116315 missense probably damaging 1.00
IGL02225:Myh15 APN 16 49091163 missense probably benign 0.14
IGL02249:Myh15 APN 16 49110484 missense probably damaging 0.99
IGL02505:Myh15 APN 16 49117263 missense possibly damaging 0.90
IGL02622:Myh15 APN 16 49176954 missense probably benign 0.02
IGL02814:Myh15 APN 16 49145438 splice site probably benign
IGL02869:Myh15 APN 16 49145404 missense probably benign
IGL02879:Myh15 APN 16 49173059 missense possibly damaging 0.68
IGL02881:Myh15 APN 16 49117265 missense possibly damaging 0.51
IGL03077:Myh15 APN 16 49096538 missense probably benign 0.10
IGL03354:Myh15 APN 16 49172010 missense probably benign 0.01
IGL03411:Myh15 APN 16 49159967 missense possibly damaging 0.58
ANU74:Myh15 UTSW 16 49172932 missense possibly damaging 0.58
P0027:Myh15 UTSW 16 49081208 missense possibly damaging 0.77
PIT1430001:Myh15 UTSW 16 49196891 critical splice donor site probably null
R0017:Myh15 UTSW 16 49163060 missense probably damaging 0.97
R0038:Myh15 UTSW 16 49071141 splice site probably benign
R0149:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0361:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0373:Myh15 UTSW 16 49182959 missense possibly damaging 0.86
R0433:Myh15 UTSW 16 49145236 missense probably damaging 1.00
R0525:Myh15 UTSW 16 49132051 missense probably benign 0.03
R0586:Myh15 UTSW 16 49171887 splice site probably benign
R0601:Myh15 UTSW 16 49061581 missense probably damaging 1.00
R0717:Myh15 UTSW 16 49142993 missense probably benign 0.03
R0963:Myh15 UTSW 16 49132149 missense probably damaging 0.97
R1075:Myh15 UTSW 16 49120054 missense possibly damaging 0.63
R1143:Myh15 UTSW 16 49065086 missense probably benign 0.02
R1200:Myh15 UTSW 16 49096519 missense probably damaging 1.00
R1644:Myh15 UTSW 16 49132203 missense probably benign 0.12
R1646:Myh15 UTSW 16 49195568 missense probably damaging 1.00
R1720:Myh15 UTSW 16 49092782 missense probably damaging 1.00
R1768:Myh15 UTSW 16 49163135 missense probably benign 0.27
R1881:Myh15 UTSW 16 49071083 missense probably damaging 0.98
R2048:Myh15 UTSW 16 49155565 missense probably damaging 0.99
R2064:Myh15 UTSW 16 49155621 missense possibly damaging 0.50
R2184:Myh15 UTSW 16 49137511 missense probably damaging 0.99
R2212:Myh15 UTSW 16 49138732 missense probably benign 0.02
R2216:Myh15 UTSW 16 49165838 nonsense probably null
R2321:Myh15 UTSW 16 49113073 missense possibly damaging 0.93
R2327:Myh15 UTSW 16 49142950 missense probably benign 0.01
R2395:Myh15 UTSW 16 49069514 missense probably benign 0.04
R2399:Myh15 UTSW 16 49137589 missense probably damaging 0.97
R3413:Myh15 UTSW 16 49138732 missense probably benign 0.02
R4234:Myh15 UTSW 16 49163042 missense probably benign 0.04
R4382:Myh15 UTSW 16 49142943 missense probably benign 0.03
R4421:Myh15 UTSW 16 49109344 missense probably damaging 0.99
R4580:Myh15 UTSW 16 49065025 missense possibly damaging 0.93
R4657:Myh15 UTSW 16 49172058 nonsense probably null
R4780:Myh15 UTSW 16 49120057 missense probably benign 0.13
R5175:Myh15 UTSW 16 49069426 missense possibly damaging 0.85
R5189:Myh15 UTSW 16 49101507 missense probably benign 0.20
R5311:Myh15 UTSW 16 49165841 missense possibly damaging 0.94
R5318:Myh15 UTSW 16 49110471 missense probably damaging 0.99
R5404:Myh15 UTSW 16 49159978 missense probably benign 0.15
R5415:Myh15 UTSW 16 49117295 missense probably null 1.00
R5558:Myh15 UTSW 16 49069537 missense probably benign 0.32
R5977:Myh15 UTSW 16 49153503 missense probably damaging 1.00
R6004:Myh15 UTSW 16 49159699 missense probably benign 0.00
R6275:Myh15 UTSW 16 49145247 missense probably benign 0.00
R6381:Myh15 UTSW 16 49101481 missense probably damaging 1.00
R6448:Myh15 UTSW 16 49171932 missense probably damaging 0.99
R6516:Myh15 UTSW 16 49137633 missense probably benign 0.19
R6752:Myh15 UTSW 16 49182927 missense probably damaging 1.00
R6847:Myh15 UTSW 16 49145088 missense possibly damaging 0.70
R6868:Myh15 UTSW 16 49069403 missense probably damaging 1.00
R6889:Myh15 UTSW 16 49153111 missense possibly damaging 0.75
R6896:Myh15 UTSW 16 49113071 missense probably benign 0.44
R6955:Myh15 UTSW 16 49081235 critical splice donor site probably null
R6984:Myh15 UTSW 16 49110412 missense probably damaging 1.00
R7046:Myh15 UTSW 16 49109299 nonsense probably null
R7095:Myh15 UTSW 16 49171909 missense possibly damaging 0.90
R7098:Myh15 UTSW 16 49177057 missense possibly damaging 0.53
R7134:Myh15 UTSW 16 49081342 missense possibly damaging 0.86
R7159:Myh15 UTSW 16 49061574 missense probably damaging 0.97
R7244:Myh15 UTSW 16 49196786 missense probably damaging 1.00
R7278:Myh15 UTSW 16 49091105 missense probably damaging 0.98
R7309:Myh15 UTSW 16 49096465 missense probably benign 0.34
R7327:Myh15 UTSW 16 49173006 missense possibly damaging 0.88
R7418:Myh15 UTSW 16 49155537 missense possibly damaging 0.69
X0012:Myh15 UTSW 16 49142978 missense probably damaging 1.00
X0020:Myh15 UTSW 16 49165874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAACCTGACTTTGTTGACTC -3'
(R):5'- GCCTGCAACTGAAGACGTAGATC -3'

Sequencing Primer
(F):5'- AACCTGACTTTGTTGACTCTGTGTC -3'
(R):5'- CATTCTTTTCTTGGACAAGGGAGAC -3'
Posted On2016-06-06