Incidental Mutation 'R5004:Dlgap1'
ID390120
Institutional Source Beutler Lab
Gene Symbol Dlgap1
Ensembl Gene ENSMUSG00000003279
Gene NameDLG associated protein 1
SynonymsGKAP/SAPAP, 4933422O14Rik, SAPAP1, Gkap, Sapap1, D17Bwg0511e, DAP-1 beta
MMRRC Submission 042597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5004 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location69969073-70821413 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 70718227 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060072] [ENSMUST00000097288] [ENSMUST00000133717] [ENSMUST00000133983] [ENSMUST00000135938] [ENSMUST00000140728] [ENSMUST00000146730] [ENSMUST00000148486] [ENSMUST00000155016]
Predicted Effect probably benign
Transcript: ENSMUST00000060072
SMART Domains Protein: ENSMUSP00000052858
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097288
SMART Domains Protein: ENSMUSP00000094890
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 208 228 N/A INTRINSIC
low complexity region 244 261 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:GKAP 345 625 9.4e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126801
Predicted Effect probably null
Transcript: ENSMUST00000133717
SMART Domains Protein: ENSMUSP00000122370
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 218 238 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
Pfam:GKAP 327 666 1.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133983
SMART Domains Protein: ENSMUSP00000116716
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135938
SMART Domains Protein: ENSMUSP00000118497
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 610 624 N/A INTRINSIC
Pfam:GKAP 625 964 9.3e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140728
SMART Domains Protein: ENSMUSP00000117358
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 216 236 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Pfam:GKAP 353 692 1.4e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146730
SMART Domains Protein: ENSMUSP00000116072
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 653 933 9.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148486
SMART Domains Protein: ENSMUSP00000122337
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 215 239 N/A INTRINSIC
low complexity region 242 259 N/A INTRINSIC
low complexity region 328 342 N/A INTRINSIC
Pfam:GKAP 343 682 1.3e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150260
Predicted Effect probably null
Transcript: ENSMUST00000155016
SMART Domains Protein: ENSMUSP00000122896
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 660 992 2e-153 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik A C 8: 13,555,927 D189E possibly damaging Het
2610528A11Rik A T 14: 37,102,665 C60S probably damaging Het
Abca5 C T 11: 110,279,376 E1298K probably damaging Het
Actg1 C A 11: 120,348,160 probably benign Het
Add2 A G 6: 86,096,746 T206A probably benign Het
Alox12e A G 11: 70,321,504 V116A probably benign Het
Ankrd27 T A 7: 35,608,375 D346E probably damaging Het
Arfgap3 T A 15: 83,310,296 S391C possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cars2 C T 8: 11,518,956 probably null Het
Cav3 A G 6: 112,459,924 K38R probably damaging Het
Ccdc159 G A 9: 21,932,945 R101H probably damaging Het
Cops7b A G 1: 86,587,410 probably benign Het
Cyp4a12b C T 4: 115,438,113 T472I probably benign Het
Cyp4a32 T C 4: 115,601,041 S23P probably damaging Het
Cyp4f13 T G 17: 32,925,786 I275L probably benign Het
Dnajc12 A T 10: 63,386,707 I4L probably benign Het
Ephb2 T A 4: 136,659,699 D739V possibly damaging Het
Fam169a A G 13: 97,097,592 Y124C probably damaging Het
Fbln5 T A 12: 101,760,821 N303I probably damaging Het
Fdxr T C 11: 115,269,573 E352G probably benign Het
Fhad1 T G 4: 142,002,599 probably null Het
Fhod1 C T 8: 105,336,945 probably benign Het
Fndc7 G A 3: 108,883,473 T79M probably damaging Het
Fry A G 5: 150,433,604 Q1872R probably benign Het
Gbx1 T C 5: 24,504,839 H336R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm13088 T C 4: 143,654,136 Q439R probably benign Het
Hacl1 C A 14: 31,619,039 C346F probably benign Het
Hectd4 C A 5: 121,328,199 probably null Het
Hectd4 C T 5: 121,329,565 P2526S possibly damaging Het
Il3ra A T 14: 14,355,381 E289D probably benign Het
Itih4 T G 14: 30,892,672 L497R probably damaging Het
Kcnh3 A T 15: 99,226,502 K91* probably null Het
Kiz C G 2: 146,969,979 D669E possibly damaging Het
Klhl30 T A 1: 91,359,324 probably null Het
Kndc1 C A 7: 139,932,879 C1514* probably null Het
Lipo2 A G 19: 33,721,676 probably null Het
Macf1 T C 4: 123,385,475 D5921G probably damaging Het
Mau2 A G 8: 70,025,887 Y394H probably damaging Het
Mctp1 T A 13: 76,641,804 S50R possibly damaging Het
Mllt10 T C 2: 18,170,268 Y3H probably damaging Het
Mon1b T C 8: 113,639,227 S396P probably damaging Het
Mrgpra4 A C 7: 47,981,787 L22R probably benign Het
Msln T G 17: 25,754,219 M1L possibly damaging Het
Myh15 T A 16: 49,132,048 I827N probably damaging Het
Myh7 T C 14: 54,971,683 D1866G probably damaging Het
Myo5b T G 18: 74,744,773 probably null Het
Nlrc5 T G 8: 94,521,216 probably benign Het
Nup210l A T 3: 90,180,165 R1082* probably null Het
Olfr1289 G A 2: 111,483,660 V105I possibly damaging Het
Olfr360 A G 2: 37,068,410 Y35C probably damaging Het
Olfr487 T A 7: 108,212,116 K138* probably null Het
Olfr860 T C 9: 19,846,102 I172M probably benign Het
Pi4ka A T 16: 17,377,169 C122S probably damaging Het
Pkd2l1 G T 19: 44,149,577 A690E probably benign Het
Prickle2 A T 6: 92,416,755 D312E probably benign Het
Prrc2a T A 17: 35,149,998 N2021Y probably benign Het
Prss3 T C 6: 41,373,902 Y218C probably damaging Het
Psg20 T C 7: 18,680,912 T350A probably damaging Het
Ptprg A T 14: 12,220,667 I1235F probably damaging Het
Ptprk T A 10: 28,586,063 D1181E possibly damaging Het
Rcc2 T A 4: 140,717,666 S415T possibly damaging Het
Ripor1 CAA CA 8: 105,618,820 probably null Het
Rnf31 T C 14: 55,592,182 L68P probably damaging Het
Rsph6a A T 7: 19,057,740 E278V possibly damaging Het
Rubcnl C T 14: 75,032,177 Q92* probably null Het
Scfd1 A G 12: 51,444,994 R580G probably benign Het
Sec31a A T 5: 100,368,333 N967K probably damaging Het
Sema4b C A 7: 80,216,345 T154N probably benign Het
Sept14 T A 5: 129,692,976 I219F possibly damaging Het
Serpinb9c A T 13: 33,150,355 S235T probably benign Het
Setd4 G T 16: 93,591,245 H118N probably benign Het
Siglec1 C T 2: 131,069,869 V1697M probably benign Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Soat2 T A 15: 102,161,111 H402Q probably damaging Het
Sp3 A T 2: 72,938,289 V666D probably benign Het
Spef2 T G 15: 9,578,327 S1704R probably benign Het
Spidr A T 16: 16,118,942 W100R possibly damaging Het
Steap1 G T 5: 5,742,829 Y27* probably null Het
Svep1 G T 4: 58,087,751 T1776K probably benign Het
Tdpoz1 T A 3: 93,671,133 T115S probably benign Het
Tet2 A T 3: 133,487,379 H431Q possibly damaging Het
Tnrc6c T G 11: 117,721,046 V170G probably benign Het
Tom1 T C 8: 75,052,002 L99P probably damaging Het
Trim11 C A 11: 58,981,338 probably benign Het
Trio T C 15: 27,755,178 K955R probably damaging Het
Tubd1 C T 11: 86,561,320 T371I probably damaging Het
Usp17lb C T 7: 104,841,677 M13I probably benign Het
Usp29 A G 7: 6,962,159 M334V probably benign Het
Usp34 A G 11: 23,464,586 Y2843C probably damaging Het
Utp20 A T 10: 88,748,273 I2674N probably damaging Het
Vmn2r14 T G 5: 109,220,380 T249P probably benign Het
Vmn2r43 A T 7: 8,244,849 F772I probably damaging Het
Vmn2r51 T A 7: 10,088,005 E584D probably benign Het
Zbtb22 G T 17: 33,917,243 A121S probably benign Het
Zfp273 A T 13: 67,825,554 H267L probably damaging Het
Zkscan2 C T 7: 123,490,044 V335M probably damaging Het
Other mutations in Dlgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dlgap1 APN 17 70516085 missense probably benign 0.02
IGL01413:Dlgap1 APN 17 70516074 missense probably benign 0.00
IGL01531:Dlgap1 APN 17 70516379 missense probably damaging 1.00
IGL02226:Dlgap1 APN 17 70516034 missense probably damaging 1.00
R0453:Dlgap1 UTSW 17 70761346 missense probably benign 0.03
R0482:Dlgap1 UTSW 17 70516190 missense probably benign 0.11
R0520:Dlgap1 UTSW 17 70516994 nonsense probably null
R1951:Dlgap1 UTSW 17 70761311 missense probably damaging 0.96
R2072:Dlgap1 UTSW 17 70662770 missense probably damaging 0.99
R2076:Dlgap1 UTSW 17 70786831 nonsense probably null
R3438:Dlgap1 UTSW 17 70516361 missense probably damaging 0.97
R3743:Dlgap1 UTSW 17 70718226 critical splice donor site probably null
R3881:Dlgap1 UTSW 17 70786815 missense probably damaging 1.00
R3981:Dlgap1 UTSW 17 70516785 missense probably damaging 1.00
R4043:Dlgap1 UTSW 17 70761080 missense probably damaging 1.00
R4272:Dlgap1 UTSW 17 70766043 missense probably benign
R4273:Dlgap1 UTSW 17 70766043 missense probably benign
R4557:Dlgap1 UTSW 17 70516689 missense probably benign 0.01
R4652:Dlgap1 UTSW 17 70761095 missense probably damaging 1.00
R4771:Dlgap1 UTSW 17 70593380 nonsense probably null
R5000:Dlgap1 UTSW 17 70766058 missense probably damaging 1.00
R5291:Dlgap1 UTSW 17 70718210 missense probably benign 0.03
R5304:Dlgap1 UTSW 17 70815207 missense probably damaging 1.00
R5473:Dlgap1 UTSW 17 70517030 intron probably benign
R5522:Dlgap1 UTSW 17 70516998 critical splice donor site probably null
R5586:Dlgap1 UTSW 17 70818161 missense probably damaging 1.00
R5742:Dlgap1 UTSW 17 70718199 missense probably benign
R5802:Dlgap1 UTSW 17 70766091 critical splice donor site probably null
R5850:Dlgap1 UTSW 17 70787092 missense probably damaging 1.00
R5857:Dlgap1 UTSW 17 70815393 intron probably benign
R5883:Dlgap1 UTSW 17 70517013 intron probably benign
R6045:Dlgap1 UTSW 17 70818098 missense probably damaging 1.00
R6336:Dlgap1 UTSW 17 70815289 missense probably damaging 1.00
R6448:Dlgap1 UTSW 17 70593330 missense possibly damaging 0.59
R6682:Dlgap1 UTSW 17 70787123 missense probably damaging 1.00
R6795:Dlgap1 UTSW 17 70818074 missense possibly damaging 0.48
R7147:Dlgap1 UTSW 17 70662758 missense probably benign 0.00
R7187:Dlgap1 UTSW 17 70516098 missense possibly damaging 0.93
R7382:Dlgap1 UTSW 17 70787174 missense probably damaging 1.00
T0975:Dlgap1 UTSW 17 70516955 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAAATGCTGATAGCTGCTGTCTTTC -3'
(R):5'- TACAGACAGACATGTGCGCC -3'

Sequencing Primer
(F):5'- AGCTGCTGTCTTTCATTTTTGAAATC -3'
(R):5'- ACATGTGCGCCCCGTATTG -3'
Posted On2016-06-06