Mutagenetix > Incidental Mutation

Incidental Mutation 'R5005:Rnd2'

390150

Institutional Source

Beutler Lab

Gene Symbol

Rnd2

Ensembl Gene

ENSMUSG00000001313

Gene Name

Rho family GTPase 2

Synonyms

Rohn, Arhn

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101359001-101362679 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101359825 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 57 (L57F)

Ref Sequence

ENSEMBL: ENSMUSP00000001347 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]

AlphaFold

Q9QYM5

Predicted Effect

probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

Domain	Start	End	E-Value	Type
RHO	10	184	5.22e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000040430

SMART Domains

Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

Domain	Start	End	E-Value	Type
low complexity region	3	31	N/A	INTRINSIC
low complexity region	41	60	N/A	INTRINSIC
Pfam:ADH_N	89	157	8.8e-11	PFAM
Pfam:ADH_zinc_N	213	355	2.1e-21	PFAM
Pfam:ADH_zinc_N_2	245	398	6.9e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134980

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153185

Meta Mutation Damage Score

0.1630

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap2b1	T	C	11: 83,230,218 (GRCm39)	V412A	probably damaging	Het
Asic2	T	C	11: 80,774,252 (GRCm39)	Y455C	probably damaging	Het
Bbx	T	C	16: 50,086,714 (GRCm39)	K61E	probably damaging	Het
Cd207	T	C	6: 83,651,367 (GRCm39)	E196G	possibly damaging	Het
Chn1	T	A	2: 73,490,130 (GRCm39)	Q49L	possibly damaging	Het
Cpd	A	G	11: 76,704,396 (GRCm39)	I406T	probably damaging	Het
D630003M21Rik	C	T	2: 158,053,563 (GRCm39)	V642I	possibly damaging	Het
Dnah7b	C	T	1: 46,281,188 (GRCm39)	L2750F	probably damaging	Het
Epyc	A	G	10: 97,510,562 (GRCm39)	T122A	probably benign	Het
Kcnt1	A	G	2: 25,791,358 (GRCm39)	H567R	probably damaging	Het
Magi2	A	G	5: 20,739,444 (GRCm39)	D729G	probably damaging	Het
Myh4	G	T	11: 67,144,241 (GRCm39)	V1204L	probably benign	Het
Noa1	T	C	5: 77,456,873 (GRCm39)	Y344C	probably damaging	Het
Or1j19	A	G	2: 36,677,370 (GRCm39)	M278V	probably benign	Het
Or4c102	A	G	2: 88,422,348 (GRCm39)	M67V	probably benign	Het
Pex1	T	C	5: 3,672,310 (GRCm39)	S718P	probably damaging	Het
Plxnb1	T	A	9: 108,935,647 (GRCm39)	V1061E	probably benign	Het
Rdh16f1	A	G	10: 127,624,546 (GRCm39)	Q128R	probably benign	Het
Slc26a9	A	T	1: 131,693,625 (GRCm39)	Q705L	probably damaging	Het
Tas2r143	T	A	6: 42,377,658 (GRCm39)	C163S	probably benign	Het
Tigd2	A	G	6: 59,188,131 (GRCm39)	T333A	probably benign	Het
Urb2	T	C	8: 124,757,920 (GRCm39)	V1209A	probably damaging	Het
Vmn2r71	T	A	7: 85,273,352 (GRCm39)	V722D	probably damaging	Het

Other mutations in Rnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Rnd2	APN	11	101,362,017 (GRCm39)	missense	possibly damaging	0.81
IGL01964:Rnd2	APN	11	101,361,632 (GRCm39)	splice site	probably null
Atkins	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R1581:Rnd2	UTSW	11	101,362,022 (GRCm39)	missense	probably benign
R4606:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R4797:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R4824:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R4825:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R4931:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5078:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5079:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5402:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5405:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5497:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5498:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5501:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5534:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5619:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5666:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5669:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5670:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5671:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5786:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5788:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5844:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5845:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5857:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5989:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5991:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R5992:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6018:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6019:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6020:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6122:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6144:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6148:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6208:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6209:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6226:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6230:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6332:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6333:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6335:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6491:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6541:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6605:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6606:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6607:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6677:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6678:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6726:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6796:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R6797:Rnd2	UTSW	11	101,359,825 (GRCm39)	missense	probably damaging	1.00
R8415:Rnd2	UTSW	11	101,362,011 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGACCAACTTCTGTCTAGGGAC -3'
(R):5'- AGACTTCCTACGTGGTTTCTG -3'

Sequencing Primer
(F):5'- CAACTTCTGTCTAGGGACTGAGC -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'

Posted On

2016-06-06