Incidental Mutation 'R5006:Zbtb38'
ID 390170
Institutional Source Beutler Lab
Gene Symbol Zbtb38
Ensembl Gene ENSMUSG00000040433
Gene Name zinc finger and BTB domain containing 38
Synonyms A930014K01Rik, Zenon homolog, CIBZ
Accession Numbers
Essential gene? Possibly essential (E-score: 0.530) question?
Stock # R5006 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 96564820-96613728 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 96567704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 1127 (G1127S)
Ref Sequence ENSEMBL: ENSMUSP00000121753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]
AlphaFold Q3LR78
Predicted Effect probably damaging
Transcript: ENSMUST00000093798
AA Change: G1127S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: G1127S

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126066
SMART Domains Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128269
SMART Domains Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140121
SMART Domains Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152594
AA Change: G1127S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: G1127S

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,781,535 (GRCm39) E51* probably null Het
Bcl11a T A 11: 24,114,989 (GRCm39) Y777* probably null Het
C2cd4c T A 10: 79,448,341 (GRCm39) T269S probably benign Het
Ciao2a G A 9: 66,043,634 (GRCm39) probably null Het
Efcab3 T A 11: 104,620,503 (GRCm39) probably null Het
Foxp1 A C 6: 99,139,819 (GRCm39) V54G probably damaging Het
Il2ra T G 2: 11,679,157 (GRCm39) L39R possibly damaging Het
Klk1b9 A T 7: 43,628,711 (GRCm39) K72* probably null Het
Lmo7 A G 14: 102,163,673 (GRCm39) probably benign Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Nebl T A 2: 17,393,582 (GRCm39) probably null Het
Or6b6 C T 7: 106,570,808 (GRCm39) V248I probably damaging Het
Or7e169 G T 9: 19,757,567 (GRCm39) A116E probably benign Het
Or7g30 A G 9: 19,352,545 (GRCm39) N112S probably benign Het
Ralgapa1 A T 12: 55,764,899 (GRCm39) C918S probably benign Het
Rasd2 G T 8: 75,945,234 (GRCm39) R21L probably damaging Het
Sema4a A G 3: 88,344,091 (GRCm39) M720T probably benign Het
Susd3 A G 13: 49,392,181 (GRCm39) probably benign Het
Vmn1r235 T C 17: 21,482,467 (GRCm39) M264T probably benign Het
Wls A G 3: 159,617,428 (GRCm39) I368V possibly damaging Het
Ypel4 A G 2: 84,567,182 (GRCm39) D5G probably benign Het
Other mutations in Zbtb38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zbtb38 APN 9 96,569,547 (GRCm39) missense probably damaging 1.00
IGL01895:Zbtb38 APN 9 96,570,461 (GRCm39) missense probably benign 0.00
IGL02513:Zbtb38 APN 9 96,569,126 (GRCm39) missense probably damaging 1.00
IGL02649:Zbtb38 APN 9 96,568,672 (GRCm39) missense probably damaging 0.96
IGL02938:Zbtb38 APN 9 96,569,227 (GRCm39) missense probably benign 0.11
PIT4131001:Zbtb38 UTSW 9 96,568,369 (GRCm39) missense probably damaging 1.00
R0048:Zbtb38 UTSW 9 96,569,729 (GRCm39) missense probably damaging 1.00
R0152:Zbtb38 UTSW 9 96,568,333 (GRCm39) missense probably damaging 1.00
R0158:Zbtb38 UTSW 9 96,568,993 (GRCm39) missense possibly damaging 0.46
R0519:Zbtb38 UTSW 9 96,567,826 (GRCm39) missense probably damaging 1.00
R0594:Zbtb38 UTSW 9 96,568,007 (GRCm39) missense probably damaging 1.00
R1556:Zbtb38 UTSW 9 96,569,044 (GRCm39) missense probably benign 0.26
R1698:Zbtb38 UTSW 9 96,567,515 (GRCm39) missense probably benign
R1772:Zbtb38 UTSW 9 96,570,094 (GRCm39) missense probably damaging 1.00
R1799:Zbtb38 UTSW 9 96,570,934 (GRCm39) missense probably damaging 1.00
R1837:Zbtb38 UTSW 9 96,569,048 (GRCm39) missense probably benign
R2446:Zbtb38 UTSW 9 96,569,699 (GRCm39) missense probably damaging 1.00
R3153:Zbtb38 UTSW 9 96,570,302 (GRCm39) missense probably benign 0.34
R3950:Zbtb38 UTSW 9 96,569,599 (GRCm39) missense probably damaging 1.00
R4240:Zbtb38 UTSW 9 96,568,155 (GRCm39) small deletion probably benign
R4630:Zbtb38 UTSW 9 96,570,904 (GRCm39) missense probably damaging 1.00
R4666:Zbtb38 UTSW 9 96,570,436 (GRCm39) missense probably damaging 1.00
R4732:Zbtb38 UTSW 9 96,569,737 (GRCm39) missense probably damaging 1.00
R4733:Zbtb38 UTSW 9 96,569,737 (GRCm39) missense probably damaging 1.00
R4824:Zbtb38 UTSW 9 96,570,254 (GRCm39) missense probably benign 0.06
R5109:Zbtb38 UTSW 9 96,569,062 (GRCm39) missense probably damaging 0.99
R5251:Zbtb38 UTSW 9 96,569,161 (GRCm39) missense probably benign 0.43
R5396:Zbtb38 UTSW 9 96,569,696 (GRCm39) missense probably damaging 1.00
R5659:Zbtb38 UTSW 9 96,569,473 (GRCm39) missense probably damaging 1.00
R6249:Zbtb38 UTSW 9 96,568,045 (GRCm39) missense probably damaging 0.99
R6294:Zbtb38 UTSW 9 96,569,282 (GRCm39) missense probably benign 0.05
R6615:Zbtb38 UTSW 9 96,568,707 (GRCm39) nonsense probably null
R6625:Zbtb38 UTSW 9 96,569,366 (GRCm39) missense probably damaging 1.00
R6885:Zbtb38 UTSW 9 96,568,517 (GRCm39) missense probably damaging 1.00
R7304:Zbtb38 UTSW 9 96,569,480 (GRCm39) missense probably damaging 0.96
R7675:Zbtb38 UTSW 9 96,567,594 (GRCm39) missense probably benign 0.00
R7823:Zbtb38 UTSW 9 96,568,029 (GRCm39) nonsense probably null
R7900:Zbtb38 UTSW 9 96,570,989 (GRCm39) missense probably damaging 1.00
R8077:Zbtb38 UTSW 9 96,570,153 (GRCm39) missense probably benign
R8432:Zbtb38 UTSW 9 96,568,291 (GRCm39) missense possibly damaging 0.68
R8802:Zbtb38 UTSW 9 96,567,623 (GRCm39) missense probably benign 0.13
R8930:Zbtb38 UTSW 9 96,568,434 (GRCm39) missense probably benign 0.04
R8932:Zbtb38 UTSW 9 96,568,434 (GRCm39) missense probably benign 0.04
R9008:Zbtb38 UTSW 9 96,569,100 (GRCm39) missense probably benign
R9347:Zbtb38 UTSW 9 96,567,649 (GRCm39) missense probably damaging 0.99
R9520:Zbtb38 UTSW 9 96,568,104 (GRCm39) missense probably damaging 0.99
R9568:Zbtb38 UTSW 9 96,570,944 (GRCm39) missense probably damaging 1.00
R9680:Zbtb38 UTSW 9 96,570,397 (GRCm39) missense probably benign 0.03
R9777:Zbtb38 UTSW 9 96,570,356 (GRCm39) missense probably damaging 0.96
R9777:Zbtb38 UTSW 9 96,570,355 (GRCm39) missense possibly damaging 0.49
R9790:Zbtb38 UTSW 9 96,570,700 (GRCm39) missense probably damaging 1.00
R9791:Zbtb38 UTSW 9 96,570,700 (GRCm39) missense probably damaging 1.00
X0066:Zbtb38 UTSW 9 96,569,665 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGGACGTTTTCAGCAAAGG -3'
(R):5'- GCGTGAAGGAGTTCATCTGTC -3'

Sequencing Primer
(F):5'- GCAAAGGCTTTTATGTCATCCTTTTG -3'
(R):5'- CATCTGTCAGTATTGTAACAAGGC -3'
Posted On 2016-06-06