Incidental Mutation 'R0436:Prrxl1'
ID39026
Institutional Source Beutler Lab
Gene Symbol Prrxl1
Ensembl Gene ENSMUSG00000041730
Gene Namepaired related homeobox protein-like 1
SynonymsDrg11
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R0436 (G1)
Quality Score171
Status Validated
Chromosome14
Chromosomal Location32599407-32649246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32608083 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 81 (F81S)
Ref Sequence ENSEMBL: ENSMUSP00000140337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068938] [ENSMUST00000186452] [ENSMUST00000187377] [ENSMUST00000189022] [ENSMUST00000228878]
Predicted Effect probably damaging
Transcript: ENSMUST00000068938
AA Change: F81S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064107
Gene: ENSMUSG00000041730
AA Change: F81S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186452
AA Change: F81S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139756
Gene: ENSMUSG00000041730
AA Change: F81S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Pfam:OAR 199 219 4.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187377
AA Change: F81S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140687
Gene: ENSMUSG00000041730
AA Change: F81S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189022
AA Change: F81S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140337
Gene: ENSMUSG00000041730
AA Change: F81S

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Pfam:OAR 199 219 4.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228878
AA Change: F81S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygous null mice had delayed projection of sensory afferent neurons in the dorsal, but not the ventral, spinal cord during embryonic development. This delayed development resulted in abnormal responses to noxious stimuli in adults, but normal locomotion and sensory motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Alx4 A T 2: 93,668,357 K145* probably null Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in Prrxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Prrxl1 APN 14 32605214 splice site probably benign
IGL01868:Prrxl1 APN 14 32608377 missense probably damaging 0.99
R1395:Prrxl1 UTSW 14 32608369 missense probably benign 0.05
R1574:Prrxl1 UTSW 14 32605324 splice site probably benign
R2093:Prrxl1 UTSW 14 32647155 intron probably benign
R3700:Prrxl1 UTSW 14 32628861 missense probably damaging 1.00
R4922:Prrxl1 UTSW 14 32608406 missense probably damaging 1.00
R4944:Prrxl1 UTSW 14 32608249 missense probably damaging 1.00
R4962:Prrxl1 UTSW 14 32647144 intron probably benign
R5512:Prrxl1 UTSW 14 32600044 missense probably damaging 0.99
R5989:Prrxl1 UTSW 14 32608188 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGATCCTGCTGGGAAAACTTCAC -3'
(R):5'- AGGTTCAGCCTGTCTACAGAGCTAC -3'

Sequencing Primer
(F):5'- GCAAAGTGGTAGATGCTTTCC -3'
(R):5'- GGAGTCAGCTAATCTTACCTCTG -3'
Posted On2013-05-23