Incidental Mutation 'R5008:Col2a1'
ID390310
Institutional Source Beutler Lab
Gene Symbol Col2a1
Ensembl Gene ENSMUSG00000022483
Gene Namecollagen, type II, alpha 1
SynonymsM100856, Col2a, Col2a-1, Del1, Col2, Rgsc856, Lpk
MMRRC Submission 042599-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5008 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location97975602-98004695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97979669 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1011 (A1011V)
Ref Sequence ENSEMBL: ENSMUSP00000085693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023123] [ENSMUST00000088355] [ENSMUST00000131560]
Predicted Effect probably benign
Transcript: ENSMUST00000023123
AA Change: A1079V

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023123
Gene: ENSMUSG00000022483
AA Change: A1079V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
Pfam:Collagen 115 175 1.3e-11 PFAM
Pfam:Collagen 199 260 7.2e-11 PFAM
Pfam:Collagen 258 317 1.3e-12 PFAM
Pfam:Collagen 312 377 4e-9 PFAM
low complexity region 395 411 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
internal_repeat_5 456 468 5.45e-5 PROSPERO
low complexity region 471 513 N/A INTRINSIC
internal_repeat_3 516 619 3.99e-13 PROSPERO
internal_repeat_1 524 567 1.6e-17 PROSPERO
low complexity region 621 633 N/A INTRINSIC
low complexity region 636 655 N/A INTRINSIC
low complexity region 659 687 N/A INTRINSIC
low complexity region 696 753 N/A INTRINSIC
internal_repeat_5 756 768 5.45e-5 PROSPERO
low complexity region 783 804 N/A INTRINSIC
Pfam:Collagen 852 918 1.1e-8 PFAM
Pfam:Collagen 876 941 1.9e-9 PFAM
Pfam:Collagen 900 966 2.4e-9 PFAM
Pfam:Collagen 983 1049 2.1e-10 PFAM
low complexity region 1062 1081 N/A INTRINSIC
Pfam:Collagen 1101 1172 3.4e-9 PFAM
Pfam:Collagen 1158 1218 1.3e-9 PFAM
COLFI 1252 1487 3.06e-184 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088355
AA Change: A1011V

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085693
Gene: ENSMUSG00000022483
AA Change: A1011V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Collagen 47 107 1.2e-11 PFAM
Pfam:Collagen 131 192 7.2e-11 PFAM
Pfam:Collagen 190 249 1.3e-12 PFAM
low complexity region 262 314 N/A INTRINSIC
Pfam:Collagen 327 405 3.5e-7 PFAM
Pfam:Collagen 361 429 7.6e-10 PFAM
internal_repeat_3 448 551 1.3e-13 PROSPERO
internal_repeat_7 454 466 2.86e-5 PROSPERO
internal_repeat_1 456 499 4.05e-18 PROSPERO
internal_repeat_6 481 504 1.7e-5 PROSPERO
low complexity region 553 565 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
low complexity region 591 619 N/A INTRINSIC
low complexity region 628 685 N/A INTRINSIC
internal_repeat_4 688 712 8.3e-12 PROSPERO
low complexity region 715 736 N/A INTRINSIC
low complexity region 747 784 N/A INTRINSIC
Pfam:Collagen 808 878 9.8e-9 PFAM
Pfam:Collagen 832 898 2.1e-9 PFAM
Pfam:Collagen 916 979 7.2e-10 PFAM
Pfam:Collagen 937 1005 2.1e-8 PFAM
Pfam:Collagen 973 1049 6e-7 PFAM
Pfam:Collagen 1030 1094 1.5e-10 PFAM
Pfam:Collagen 1088 1150 1.4e-9 PFAM
COLFI 1184 1419 3.06e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131560
SMART Domains Protein: ENSMUSP00000116951
Gene: ENSMUSG00000022483

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
low complexity region 109 132 N/A INTRINSIC
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type II collagen, the major component of cartilage and the vitreous humor of the eye. The encoded preproprotein forms homotrimeric, triple helical procollagen that undergoes proteolytic processing during fibirl formation. Mice harboring certain mutations in this gene exhibit severe chondrodysplasia characterized by short limbs and trunch, craniofacial deformities and cleft palate. A complete lack of the encoded protein in mice results in postnatal lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this locus affect cartilage development. Homozygotes die perinatally with anomalies such as shortened limbs without epiphiseal growth plates, cleft palate and persistence of notochord. Heterozygotes are dwarfed with reduced cartilage matrix. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
2310057N15Rik A G 16: 88,773,775 Y126H probably damaging Het
Catsperg1 A T 7: 29,195,434 Y579* probably null Het
Chchd5 A T 2: 129,130,399 probably null Het
Chd1l T C 3: 97,583,908 N423D probably damaging Het
Cntnap1 G A 11: 101,188,741 W1268* probably null Het
Cst11 A G 2: 148,770,405 I104T probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Dnah17 A G 11: 118,110,577 F847L probably benign Het
Dspp A T 5: 104,175,573 H194L possibly damaging Het
Dyx1c1 T C 9: 72,972,318 probably benign Het
Frmd5 C A 2: 121,548,860 R414L probably damaging Het
Galnt3 C A 2: 66,085,241 R592L probably benign Het
Gm13128 A G 4: 144,331,266 S148G probably benign Het
Gm38706 T A 6: 130,484,617 noncoding transcript Het
Gm38706 T A 6: 130,485,020 noncoding transcript Het
Hivep3 A G 4: 120,098,917 K1477E probably benign Het
Igsf3 C T 3: 101,450,917 T708M probably damaging Het
Ikzf4 T G 10: 128,641,250 E64A probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Krt83 T A 15: 101,491,224 I76F probably damaging Het
Lat2 A G 5: 134,603,137 V152A probably benign Het
Lrp12 C T 15: 39,878,456 D288N probably damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myh4 T A 11: 67,253,532 S1243T probably benign Het
Myo3b T A 2: 70,258,068 F892I probably damaging Het
Nckap5l T C 15: 99,425,850 N924S possibly damaging Het
Npnt C T 3: 132,906,457 C218Y probably damaging Het
Olfr434 T A 6: 43,217,057 I48N probably damaging Het
Olfr715b A T 7: 107,106,081 M260K probably damaging Het
Olfr8 T A 10: 78,956,071 F289I probably damaging Het
Pfkm G A 15: 98,122,689 C233Y probably benign Het
Pigq A G 17: 25,934,203 V338A probably benign Het
Pld4 A T 12: 112,768,050 N415I possibly damaging Het
Pmm1 A T 15: 81,957,894 probably null Het
Polg G T 7: 79,460,074 P394T probably damaging Het
Polq A T 16: 37,062,387 I1359L probably benign Het
Pros1 A G 16: 62,928,185 N674D possibly damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Rasa3 A T 8: 13,584,959 C453* probably null Het
Repin1 T C 6: 48,596,608 V101A probably damaging Het
Rnf186 A T 4: 138,967,229 M27L probably benign Het
Rpa1 A G 11: 75,313,299 probably null Het
Rph3a G T 5: 120,945,391 N605K probably damaging Het
Rps18 A T 17: 33,952,284 probably null Het
Scgn A G 13: 23,990,975 I20T probably damaging Het
Skint6 A T 4: 112,991,255 V652E possibly damaging Het
Slc23a2 T C 2: 132,101,494 H29R probably damaging Het
Slc34a3 C T 2: 25,230,842 V383I possibly damaging Het
Slc5a1 A G 5: 33,152,573 M382V possibly damaging Het
Slc5a3 T A 16: 92,077,281 S75R probably damaging Het
Stat5b G C 11: 100,802,483 H111D probably benign Het
Tanc2 G A 11: 105,625,060 M1I probably null Het
Tbcel C T 9: 42,416,123 G328E probably damaging Het
Tecta C A 9: 42,373,062 R909L possibly damaging Het
Tnip1 A T 11: 54,937,984 M119K probably benign Het
Wdr34 C A 2: 30,032,769 R322L probably benign Het
Zbbx A C 3: 75,151,448 S51A possibly damaging Het
Zc3h12c T C 9: 52,116,700 N454S probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Col2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Col2a1 APN 15 97976173 missense unknown
IGL01286:Col2a1 APN 15 97994878 missense unknown
IGL01369:Col2a1 APN 15 97977826 missense unknown
IGL01747:Col2a1 APN 15 97991392 splice site probably benign
IGL02086:Col2a1 APN 15 97986737 splice site probably null
IGL02549:Col2a1 APN 15 97977799 missense unknown
IGL03289:Col2a1 APN 15 97980881 missense unknown
IGL03369:Col2a1 APN 15 97982042 missense unknown
FR4304:Col2a1 UTSW 15 97988981 synonymous probably null
FR4340:Col2a1 UTSW 15 97988981 synonymous probably null
FR4342:Col2a1 UTSW 15 97988981 synonymous probably null
FR4589:Col2a1 UTSW 15 97988981 synonymous probably null
LCD18:Col2a1 UTSW 15 97988981 synonymous probably null
R0124:Col2a1 UTSW 15 97998862 missense unknown
R0227:Col2a1 UTSW 15 97976755 missense unknown
R0690:Col2a1 UTSW 15 97980192 missense unknown
R1434:Col2a1 UTSW 15 97979651 missense probably damaging 0.96
R1473:Col2a1 UTSW 15 97982908 splice site probably benign
R1577:Col2a1 UTSW 15 97979202 missense probably damaging 1.00
R1598:Col2a1 UTSW 15 97979250 missense probably damaging 0.99
R1837:Col2a1 UTSW 15 97996641 splice site probably benign
R2153:Col2a1 UTSW 15 97987580 missense unknown
R2965:Col2a1 UTSW 15 97976095 missense unknown
R2966:Col2a1 UTSW 15 97976095 missense unknown
R3710:Col2a1 UTSW 15 97990907 splice site probably benign
R3838:Col2a1 UTSW 15 97988976 missense unknown
R3838:Col2a1 UTSW 15 98000581 intron probably benign
R4112:Col2a1 UTSW 15 97983701 missense probably benign 0.18
R4417:Col2a1 UTSW 15 97998585 missense unknown
R4656:Col2a1 UTSW 15 97976176 missense unknown
R4960:Col2a1 UTSW 15 97976149 missense unknown
R5435:Col2a1 UTSW 15 98000510 intron probably benign
R5473:Col2a1 UTSW 15 97987489 missense unknown
R6042:Col2a1 UTSW 15 98000570 intron probably benign
R6118:Col2a1 UTSW 15 97998567 missense unknown
R6183:Col2a1 UTSW 15 97988790 missense unknown
R6187:Col2a1 UTSW 15 97988790 missense unknown
R6401:Col2a1 UTSW 15 97985892 missense unknown
R6550:Col2a1 UTSW 15 97976793 missense unknown
R6568:Col2a1 UTSW 15 97977276 missense unknown
R6988:Col2a1 UTSW 15 98004454 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCAGGACATGAAACCCCTC -3'
(R):5'- CAAGGTAAGTGACTGGCGTC -3'

Sequencing Primer
(F):5'- ATGAAACCCCTCGTCTACATCTG -3'
(R):5'- ATGGGGGTTCCGGGAAC -3'
Posted On2016-06-06