Incidental Mutation 'R0436:Adrb2'
ID39033
Institutional Source Beutler Lab
Gene Symbol Adrb2
Ensembl Gene ENSMUSG00000045730
Gene Nameadrenergic receptor, beta 2
SynonymsGpcr7, beta 2-AR, Adrb-2, beta 2-adrenoceptor, Badm
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0436 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location62177817-62179959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62179553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000062256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053640] [ENSMUST00000067743]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053640
AA Change: V67A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062256
Gene: ENSMUSG00000045730
AA Change: V67A

DomainStartEndE-ValueType
Pfam:7tm_4 40 246 4.7e-10 PFAM
Pfam:7TM_GPCR_Srx 41 250 2.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 43 340 1.4e-15 PFAM
Pfam:7tm_1 50 326 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067743
SMART Domains Protein: ENSMUSP00000065944
Gene: ENSMUSG00000054589

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This intronless gene belongs to the G-protein-coupled receptor superfamily, which includes transmembrane proteins that play a role in signal transduction across biological membranes resulting in a variety of physiological responses. The encoded protein is a beta-2 adrenergic receptor which is activated by catecholamine ligands such as adrenaline and epinephrine. The protein participates in the classical signaling pathway involving G protein, adenylyl cyclase, cAMP (3'-5'-cyclic adenosine monophosphate) and protein kinase A (PKA). In humans, this gene is implicated in susceptibility to nocturnal asthma, obesity and type 2 diabetes. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene exhibit increased bone mass. The primary physiological consequences are seen during exercise stress and result from alterations in vascular tone and energy metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Alx4 A T 2: 93,668,357 K145* probably null Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in Adrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Adrb2 APN 18 62179007 missense probably benign 0.00
PIT4514001:Adrb2 UTSW 18 62179727 missense probably benign 0.00
R0091:Adrb2 UTSW 18 62179019 missense probably benign
R0420:Adrb2 UTSW 18 62179539 missense possibly damaging 0.76
R0604:Adrb2 UTSW 18 62178515 missense possibly damaging 0.49
R0626:Adrb2 UTSW 18 62179370 missense probably damaging 1.00
R0843:Adrb2 UTSW 18 62179071 missense probably benign 0.03
R0940:Adrb2 UTSW 18 62179691 missense probably benign 0.00
R1498:Adrb2 UTSW 18 62178933 missense probably damaging 1.00
R1517:Adrb2 UTSW 18 62178800 missense probably damaging 1.00
R1603:Adrb2 UTSW 18 62179508 missense probably damaging 1.00
R1944:Adrb2 UTSW 18 62179413 missense probably damaging 1.00
R4367:Adrb2 UTSW 18 62179056 missense probably damaging 1.00
R5143:Adrb2 UTSW 18 62178776 missense probably damaging 1.00
R5468:Adrb2 UTSW 18 62179625 missense probably damaging 1.00
R5644:Adrb2 UTSW 18 62178682 missense probably benign 0.01
R6073:Adrb2 UTSW 18 62179466 missense probably benign 0.01
R6753:Adrb2 UTSW 18 62179553 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGCTGTGACGCACAACACATC -3'
(R):5'- AAGGCTGCTTCTCAGGCATTCAGG -3'

Sequencing Primer
(F):5'- TCAATGGAAGTCCAGAACTCG -3'
(R):5'- GAACGACAGCGACTTCTTG -3'
Posted On2013-05-23