Incidental Mutation 'R0437:Ush2a'
ID39037
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Nameusherin
SynonymsA930011D15Rik, LOC381317, A930037M10Rik, LOC269160, Usherin, MUSH2A
MMRRC Submission 038638-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R0437 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location188262023-188965041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 188911031 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 4197 (W4197G)
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
Predicted Effect probably benign
Transcript: ENSMUST00000060479
AA Change: W4197G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609
AA Change: W4197G

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Meta Mutation Damage Score 0.1488 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,953 L21P probably damaging Het
4833420G17Rik G A 13: 119,470,095 R291K probably benign Het
4932438A13Rik A T 3: 36,989,804 H2820L possibly damaging Het
Abca2 T C 2: 25,442,845 S1519P probably damaging Het
Abcb11 G A 2: 69,257,295 A1042V probably damaging Het
Abcc10 A T 17: 46,312,919 probably null Het
Abcc10 G T 17: 46,312,920 probably benign Het
Alkbh3 A C 2: 93,981,569 L240V probably damaging Het
Apol10b T C 15: 77,585,408 S190G probably benign Het
Atp1a3 C A 7: 24,998,967 C135F probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
BC030499 T C 11: 78,291,536 L57P probably benign Het
Bicra A G 7: 15,988,762 S277P possibly damaging Het
Bmp8a T C 4: 123,316,897 E275G probably benign Het
Ccdc102a T C 8: 94,913,426 E80G probably damaging Het
Cdh23 T C 10: 60,410,797 D954G probably damaging Het
Chrm4 A G 2: 91,928,443 T399A possibly damaging Het
Clcn3 A G 8: 60,934,537 V199A possibly damaging Het
Crlf1 T C 8: 70,499,514 probably null Het
Crx G T 7: 15,871,146 S57* probably null Het
Cyp4f16 A G 17: 32,537,098 I34V possibly damaging Het
Daxx T C 17: 33,913,624 V576A probably benign Het
Ddx17 C T 15: 79,537,471 R351H probably damaging Het
Dhx38 T C 8: 109,558,629 probably benign Het
Dnd1 T C 18: 36,764,499 probably benign Het
Dync1i2 A T 2: 71,227,825 probably null Het
E2f6 T C 12: 16,816,445 S52P probably benign Het
Epb41l4a A G 18: 33,880,273 F116S probably damaging Het
Ext1 T C 15: 53,106,106 N362S probably damaging Het
Fam227a C A 15: 79,643,988 K79N possibly damaging Het
Fam228a T A 12: 4,732,759 L111F probably damaging Het
Fat2 T C 11: 55,282,799 T2363A probably benign Het
Fat3 A T 9: 15,996,932 N2591K probably damaging Het
Frem2 A G 3: 53,653,015 M1357T possibly damaging Het
Frmd4b A T 6: 97,423,463 V29D probably damaging Het
G930045G22Rik A G 6: 50,846,938 noncoding transcript Het
Galnt3 A G 2: 66,107,229 S46P possibly damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Herc2 C T 7: 56,219,815 R4271* probably null Het
Il5 C A 11: 53,723,906 probably benign Het
Ints9 G A 14: 64,986,369 probably benign Het
Itga10 T C 3: 96,649,137 F196S probably damaging Het
Itgb3bp T C 4: 99,781,889 T138A probably damaging Het
Kcnd1 G A X: 7,824,683 V281M probably benign Het
Lcp2 T C 11: 34,087,229 L391P probably benign Het
Lrrc66 T C 5: 73,607,687 Y671C probably benign Het
Mettl23 T C 11: 116,849,294 V197A possibly damaging Het
Mmp15 C A 8: 95,370,772 D456E probably benign Het
Mospd4 T C 18: 46,465,781 noncoding transcript Het
Mov10l1 C A 15: 89,005,312 H484N probably damaging Het
Mphosph9 T C 5: 124,315,568 Q197R probably benign Het
Ms4a1 T A 19: 11,256,569 probably null Het
Mybbp1a T C 11: 72,448,848 V919A possibly damaging Het
Mycbpap A T 11: 94,513,512 probably benign Het
Naip6 G A 13: 100,296,924 S1135F possibly damaging Het
Ndufc2 T A 7: 97,400,337 M50K probably benign Het
Npr2 T C 4: 43,648,082 V842A probably damaging Het
Ntsr2 G T 12: 16,653,695 G66W probably damaging Het
Obscn T C 11: 58,995,088 probably benign Het
Olfr1206 T A 2: 88,864,885 N93K probably benign Het
Olfr1219 T A 2: 89,074,612 I160F probably benign Het
Olfr427 G A 1: 174,100,399 G314R probably benign Het
Olfr820 T C 10: 130,018,096 V245A probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Otud4 T A 8: 79,669,997 H628Q probably benign Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pex16 G T 2: 92,375,592 R10L probably damaging Het
Pitpnm2 A G 5: 124,131,089 probably benign Het
Pom121l2 A G 13: 21,983,205 T549A possibly damaging Het
Prdm15 A T 16: 97,812,559 M470K probably benign Het
Prkag2 T A 5: 25,028,505 D49V possibly damaging Het
Prl3c1 A G 13: 27,199,464 M38V probably benign Het
Prpf18 T A 2: 4,643,761 I85F possibly damaging Het
Psg27 A G 7: 18,560,711 probably benign Het
Relt A G 7: 100,848,784 probably benign Het
Serpina3b A T 12: 104,130,670 N70I probably damaging Het
Slc19a3 T C 1: 83,022,565 S244G probably benign Het
Slc39a5 T C 10: 128,399,847 T81A possibly damaging Het
Slc7a2 G A 8: 40,904,526 G277D probably damaging Het
Slc9c1 C T 16: 45,599,887 probably benign Het
Slx1b A G 7: 126,692,581 F104L probably benign Het
Smg6 G A 11: 74,929,701 S266N probably damaging Het
Spata9 T C 13: 75,998,495 V162A possibly damaging Het
Szrd1 T C 4: 141,118,744 I47V probably benign Het
Tha1 G T 11: 117,868,575 L363M probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Tmem132d C T 5: 127,789,785 G684R probably damaging Het
Trim55 G A 3: 19,670,978 G220S probably benign Het
Ttn A G 2: 76,770,530 L18836P probably damaging Het
Ubn1 G T 16: 5,072,184 probably benign Het
Vmn1r189 A T 13: 22,102,061 V202E probably damaging Het
Vmn1r209 T C 13: 22,806,356 I55V probably benign Het
Vmn2r86 A T 10: 130,446,543 C735S probably damaging Het
Vwf A T 6: 125,566,318 D174V probably damaging Het
Zfp438 T C 18: 5,214,910 N16S probably damaging Het
Zfp444 C T 7: 6,189,409 T142I probably benign Het
Zfp804a A G 2: 82,053,791 M1V probably null Het
Zfp936 T G 7: 43,189,310 I67S probably benign Het
Zfp948 A T 17: 21,586,998 N151Y unknown Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188864678 missense probably benign 0.00
IGL00391:Ush2a APN 1 188916061 missense probably damaging 1.00
IGL00429:Ush2a APN 1 188400114 nonsense probably null
IGL00484:Ush2a APN 1 188782513 missense probably benign 0.00
IGL00519:Ush2a APN 1 188444668 missense probably benign 0.03
IGL00567:Ush2a APN 1 188964917 missense probably damaging 1.00
IGL00823:Ush2a APN 1 188911443 missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188357961 nonsense probably null
IGL00951:Ush2a APN 1 188263465 missense probably benign 0.33
IGL00956:Ush2a APN 1 188753522 missense probably damaging 0.99
IGL01096:Ush2a APN 1 188678377 missense probably damaging 1.00
IGL01108:Ush2a APN 1 188862825 missense probably benign 0.00
IGL01315:Ush2a APN 1 188633614 missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188814353 missense probably benign 0.00
IGL01324:Ush2a APN 1 188848992 missense probably benign 0.38
IGL01326:Ush2a APN 1 188263321 nonsense probably null
IGL01384:Ush2a APN 1 188553228 missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188911622 missense probably benign 0.00
IGL01518:Ush2a APN 1 188399785 missense probably benign 0.01
IGL01585:Ush2a APN 1 188430727 missense probably damaging 1.00
IGL01595:Ush2a APN 1 188654724 critical splice donor site probably null
IGL01657:Ush2a APN 1 188826461 missense probably benign 0.03
IGL01797:Ush2a APN 1 188263509 missense probably damaging 1.00
IGL01802:Ush2a APN 1 188436957 missense probably damaging 0.99
IGL01836:Ush2a APN 1 188759863 splice site probably benign
IGL01938:Ush2a APN 1 188797845 missense probably damaging 1.00
IGL01976:Ush2a APN 1 188911241 missense probably benign 0.04
IGL02023:Ush2a APN 1 188733514 missense probably benign 0.03
IGL02126:Ush2a APN 1 188263391 missense probably benign 0.01
IGL02133:Ush2a APN 1 188443343 missense probably damaging 1.00
IGL02147:Ush2a APN 1 188864703 missense probably benign
IGL02275:Ush2a APN 1 188263269 missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188633629 missense probably benign 0.00
IGL02353:Ush2a APN 1 188728438 missense probably benign 0.04
IGL02360:Ush2a APN 1 188728438 missense probably benign 0.04
IGL02367:Ush2a APN 1 188784746 missense probably benign
IGL02402:Ush2a APN 1 188267108 missense probably benign 0.02
IGL02410:Ush2a APN 1 188915997 missense probably damaging 1.00
IGL02490:Ush2a APN 1 188810364 missense probably damaging 1.00
IGL02500:Ush2a APN 1 188822696 missense probably damaging 1.00
IGL02511:Ush2a APN 1 188743687 critical splice donor site probably null
IGL02517:Ush2a APN 1 188915998 missense probably damaging 1.00
IGL02536:Ush2a APN 1 188957266 critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188728333 missense probably benign 0.00
IGL02610:Ush2a APN 1 188444466 missense probably damaging 0.98
IGL02677:Ush2a APN 1 188734685 missense probably damaging 1.00
IGL02691:Ush2a APN 1 188734752 missense probably damaging 1.00
IGL02740:Ush2a APN 1 188648388 missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188358717 splice site probably null
IGL02749:Ush2a APN 1 188946958 missense probably damaging 0.99
IGL02806:Ush2a APN 1 188810357 nonsense probably null
IGL02870:Ush2a APN 1 188678358 missense probably benign 0.42
IGL02894:Ush2a APN 1 188451846 missense probably damaging 1.00
IGL02904:Ush2a APN 1 188906506 missense probably benign 0.06
IGL03000:Ush2a APN 1 188549856 missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188436950 missense probably benign 0.01
IGL03036:Ush2a APN 1 188864621 missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188797838 missense probably damaging 1.00
IGL03230:Ush2a APN 1 188466193 missense probably benign 0.09
IGL03278:Ush2a APN 1 188849116 missense probably damaging 1.00
PIT4283001:Ush2a UTSW 1 188436867 missense probably benign 0.01
R0003:Ush2a UTSW 1 188578491 missense probably damaging 0.99
R0030:Ush2a UTSW 1 188822657 missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188356888 missense probably benign
R0038:Ush2a UTSW 1 188626612 missense probably benign 0.00
R0038:Ush2a UTSW 1 188626612 missense probably benign 0.00
R0067:Ush2a UTSW 1 188964846 missense probably damaging 0.99
R0067:Ush2a UTSW 1 188964846 missense probably damaging 0.99
R0103:Ush2a UTSW 1 188319070 missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188319070 missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188948455 missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188531761 missense probably damaging 0.99
R0208:Ush2a UTSW 1 188531761 missense probably damaging 0.99
R0230:Ush2a UTSW 1 188850104 missense probably damaging 1.00
R0269:Ush2a UTSW 1 188810176 missense probably benign 0.33
R0319:Ush2a UTSW 1 188948374 splice site probably benign
R0358:Ush2a UTSW 1 188537780 missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188451819 missense probably damaging 1.00
R0427:Ush2a UTSW 1 188400281 missense probably damaging 1.00
R0462:Ush2a UTSW 1 188910939 missense probably benign
R0510:Ush2a UTSW 1 188734663 splice site probably benign
R0531:Ush2a UTSW 1 188443181 missense probably benign 0.18
R0541:Ush2a UTSW 1 188714466 splice site probably benign
R0549:Ush2a UTSW 1 188946953 missense probably damaging 0.99
R0562:Ush2a UTSW 1 188356847 missense probably damaging 1.00
R0636:Ush2a UTSW 1 188822738 missense probably benign
R0662:Ush2a UTSW 1 188351093 missense probably benign 0.26
R0685:Ush2a UTSW 1 188400278 missense probably damaging 1.00
R0718:Ush2a UTSW 1 188797830 missense probably damaging 1.00
R0725:Ush2a UTSW 1 188951525 missense probably damaging 1.00
R0735:Ush2a UTSW 1 188864693 missense probably benign 0.04
R0744:Ush2a UTSW 1 188814406 splice site probably benign
R0765:Ush2a UTSW 1 188948574 missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188542818 nonsense probably null
R1067:Ush2a UTSW 1 188550207 missense probably benign 0.35
R1072:Ush2a UTSW 1 188728717 missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188648348 missense probably benign 0.06
R1099:Ush2a UTSW 1 188864639 missense probably damaging 1.00
R1104:Ush2a UTSW 1 188916256 missense probably benign
R1106:Ush2a UTSW 1 188910983 missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188753536 missense probably damaging 0.99
R1168:Ush2a UTSW 1 188678411 missense probably benign 0.01
R1199:Ush2a UTSW 1 188759795 missense probably benign 0.00
R1215:Ush2a UTSW 1 188957282 missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188357967 missense probably damaging 1.00
R1307:Ush2a UTSW 1 188451840 missense probably damaging 1.00
R1311:Ush2a UTSW 1 188947145 missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188523318 splice site probably benign
R1416:Ush2a UTSW 1 188436883 missense probably damaging 1.00
R1424:Ush2a UTSW 1 188542878 critical splice donor site probably null
R1459:Ush2a UTSW 1 188862851 missense probably benign 0.05
R1470:Ush2a UTSW 1 188400206 missense probably benign 0.00
R1470:Ush2a UTSW 1 188400206 missense probably benign 0.00
R1477:Ush2a UTSW 1 188849076 missense probably benign 0.05
R1484:Ush2a UTSW 1 188810337 nonsense probably null
R1490:Ush2a UTSW 1 188359841 missense probably benign 0.24
R1510:Ush2a UTSW 1 188648304 missense probably damaging 1.00
R1522:Ush2a UTSW 1 188797814 missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188759766 missense probably benign 0.17
R1618:Ush2a UTSW 1 188814224 missense probably benign 0.29
R1636:Ush2a UTSW 1 188466176 missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188415821 missense probably damaging 1.00
R1660:Ush2a UTSW 1 188916064 missense probably benign
R1676:Ush2a UTSW 1 188728585 missense probably damaging 1.00
R1704:Ush2a UTSW 1 188821796 missense probably damaging 1.00
R1705:Ush2a UTSW 1 188874869 missense probably damaging 1.00
R1705:Ush2a UTSW 1 188911541 missense probably benign 0.40
R1760:Ush2a UTSW 1 188910983 missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188728203 missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188911185 missense probably benign 0.06
R1794:Ush2a UTSW 1 188862809 missense probably benign 0.00
R1796:Ush2a UTSW 1 188910827 missense probably benign 0.11
R1804:Ush2a UTSW 1 188633729 critical splice donor site probably null
R1835:Ush2a UTSW 1 188451818 missense probably benign 0.13
R1871:Ush2a UTSW 1 188826468 missense probably benign 0.02
R1876:Ush2a UTSW 1 188678289 missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188399980 missense probably benign 0.05
R1896:Ush2a UTSW 1 188550009 missense probably benign 0.00
R1907:Ush2a UTSW 1 188715064 missense probably benign 0.01
R1940:Ush2a UTSW 1 188951561 missense probably null 0.89
R1950:Ush2a UTSW 1 188755185 missense probably damaging 1.00
R1991:Ush2a UTSW 1 188578532 splice site probably benign
R2043:Ush2a UTSW 1 188916256 missense probably benign 0.00
R2046:Ush2a UTSW 1 188356927 missense probably benign 0.01
R2059:Ush2a UTSW 1 188381549 critical splice donor site probably null
R2239:Ush2a UTSW 1 188576214 missense probably benign
R2365:Ush2a UTSW 1 188378991 missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188947040 missense probably damaging 1.00
R2425:Ush2a UTSW 1 188537804 missense possibly damaging 0.82
R2519:Ush2a UTSW 1 188267107 missense probably benign
R3039:Ush2a UTSW 1 188911547 missense probably damaging 0.99
R3434:Ush2a UTSW 1 188733758 missense probably damaging 1.00
R3711:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3712:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3732:Ush2a UTSW 1 188944760 missense probably benign 0.16
R3746:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3747:Ush2a UTSW 1 188810292 missense probably benign 0.05
R3883:Ush2a UTSW 1 188263382 missense probably benign
R3911:Ush2a UTSW 1 188399954 missense probably benign 0.05
R3934:Ush2a UTSW 1 188263511 critical splice donor site probably null
R3946:Ush2a UTSW 1 188728504 missense probably benign 0.01
R3974:Ush2a UTSW 1 188381501 missense probably benign 0.06
R4158:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4159:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4161:Ush2a UTSW 1 188728710 missense probably damaging 1.00
R4162:Ush2a UTSW 1 188743680 missense probably benign 0.00
R4255:Ush2a UTSW 1 188759843 nonsense probably null
R4280:Ush2a UTSW 1 188578461 missense probably benign 0.16
R4387:Ush2a UTSW 1 188443431 missense probably benign 0.00
R4416:Ush2a UTSW 1 188356874 missense probably damaging 0.97
R4494:Ush2a UTSW 1 188553276 missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188728596 missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188864625 missense probably damaging 1.00
R4584:Ush2a UTSW 1 188451798 missense probably benign 0.00
R4599:Ush2a UTSW 1 188911647 missense probably benign 0.01
R4605:Ush2a UTSW 1 188910801 missense probably damaging 1.00
R4632:Ush2a UTSW 1 188395874 missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188399941 missense probably benign 0.01
R4751:Ush2a UTSW 1 188850087 missense probably damaging 0.98
R4770:Ush2a UTSW 1 188549879 missense probably benign 0.25
R4771:Ush2a UTSW 1 188797769 missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188743545 missense probably damaging 1.00
R4821:Ush2a UTSW 1 188753651 missense probably benign 0.32
R4857:Ush2a UTSW 1 188537720 missense probably benign 0.01
R4860:Ush2a UTSW 1 188553275 missense probably benign 0.07
R4860:Ush2a UTSW 1 188553275 missense probably benign 0.07
R4898:Ush2a UTSW 1 188626608 missense probably benign 0.37
R4993:Ush2a UTSW 1 188910720 missense probably benign 0.03
R5035:Ush2a UTSW 1 188910808 missense probably damaging 1.00
R5061:Ush2a UTSW 1 188957274 missense probably benign 0.03
R5150:Ush2a UTSW 1 188451870 missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188874936 missense probably benign 0.21
R5212:Ush2a UTSW 1 188444705 critical splice donor site probably null
R5252:Ush2a UTSW 1 188821717 missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188947079 missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188356798 missense probably damaging 0.99
R5323:Ush2a UTSW 1 188821677 critical splice acceptor site probably null
R5330:Ush2a UTSW 1 188728381 missense probably benign 0.00
R5331:Ush2a UTSW 1 188728381 missense probably benign 0.00
R5332:Ush2a UTSW 1 188351079 missense probably damaging 1.00
R5371:Ush2a UTSW 1 188443070 missense probably benign 0.00
R5374:Ush2a UTSW 1 188755206 missense probably benign
R5377:Ush2a UTSW 1 188912123 missense probably benign 0.00
R5525:Ush2a UTSW 1 188753606 missense probably benign 0.01
R5558:Ush2a UTSW 1 188797827 missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188576217 missense probably damaging 1.00
R5595:Ush2a UTSW 1 188906498 missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188759823 missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188400257 missense probably benign 0.00
R5743:Ush2a UTSW 1 188436962 missense probably benign 0.01
R5779:Ush2a UTSW 1 188443510 critical splice donor site probably null
R5795:Ush2a UTSW 1 188443397 missense probably benign 0.34
R5897:Ush2a UTSW 1 188821738 missense probably damaging 1.00
R5918:Ush2a UTSW 1 188356814 missense probably benign 0.26
R6000:Ush2a UTSW 1 188267026 nonsense probably null
R6014:Ush2a UTSW 1 188850040 missense probably damaging 0.98
R6017:Ush2a UTSW 1 188957514 critical splice donor site probably null
R6020:Ush2a UTSW 1 188728096 splice site probably null
R6039:Ush2a UTSW 1 188319020 missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188319020 missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188957324 missense probably benign 0.06
R6083:Ush2a UTSW 1 188267023 missense probably damaging 1.00
R6091:Ush2a UTSW 1 188399803 missense probably damaging 1.00
R6120:Ush2a UTSW 1 188358603 missense probably benign 0.04
R6135:Ush2a UTSW 1 188912106 missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188357963 missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188728270 missense probably benign 0.00
R6180:Ush2a UTSW 1 188399871 nonsense probably null
R6191:Ush2a UTSW 1 188263101 nonsense probably null
R6217:Ush2a UTSW 1 188743454 intron probably null
R6263:Ush2a UTSW 1 188358642 missense probably damaging 1.00
R6294:Ush2a UTSW 1 188536370 missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188356846 missense probably benign 0.01
R6321:Ush2a UTSW 1 188849046 nonsense probably null
R6347:Ush2a UTSW 1 188910887 missense probably benign
R6382:Ush2a UTSW 1 188814302 missense probably benign 0.01
R6408:Ush2a UTSW 1 188267032 nonsense probably null
R6418:Ush2a UTSW 1 188628566 missense probably damaging 1.00
R6500:Ush2a UTSW 1 188841527 missense probably benign 0.00
R6504:Ush2a UTSW 1 188911247 missense probably benign 0.00
R6534:Ush2a UTSW 1 188451802 nonsense probably null
R6594:Ush2a UTSW 1 188910798 missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188911397 missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188523331 missense probably damaging 0.99
R6658:Ush2a UTSW 1 188814359 missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188753684 missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188443219 missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188356834 missense probably benign
R6817:Ush2a UTSW 1 188862864 missense probably benign 0.03
R6834:Ush2a UTSW 1 188356792 missense probably damaging 1.00
R6851:Ush2a UTSW 1 188533205 missense probably benign 0.06
R6853:Ush2a UTSW 1 188911237 nonsense probably null
R6867:Ush2a UTSW 1 188910973 missense probably damaging 1.00
R6889:Ush2a UTSW 1 188797871 missense probably damaging 1.00
R6931:Ush2a UTSW 1 188728383 missense probably benign 0.01
R6953:Ush2a UTSW 1 188263145 missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188576244 missense probably damaging 1.00
R7109:Ush2a UTSW 1 188381484 missense probably benign 0.19
R7153:Ush2a UTSW 1 188728484 missense possibly damaging 0.93
U24488:Ush2a UTSW 1 188430766 missense probably damaging 0.99
X0011:Ush2a UTSW 1 188318969 missense probably benign 0.00
X0024:Ush2a UTSW 1 188400282 missense probably damaging 1.00
X0026:Ush2a UTSW 1 188319025 missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188549854 missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188743629 missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188743629 missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188911983 missense probably benign
Z1088:Ush2a UTSW 1 188947004 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AAGCCCCTCCAGATACTCAGATGG -3'
(R):5'- TGAAATTGAGAGCAGGAAGCACTCC -3'

Sequencing Primer
(F):5'- TCCAGATACTCAGATGGCTCCTAC -3'
(R):5'- AAGTCTGTAGCCCTGGATGAC -3'
Posted On2013-05-23