Incidental Mutation 'R5010:Myom2'
ID390439
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15083310 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 401 (V401M)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect probably damaging
Transcript: ENSMUST00000033842
AA Change: V401M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: V401M

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 intron probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
Predicted Primers PCR Primer
(F):5'- TCAGTCTGCTGGGTTAATAAACAC -3'
(R):5'- TACGCTCCTGAATGGGTCTGTC -3'

Sequencing Primer
(F):5'- CTTTAGTGATAAAGACCAAACTGAGC -3'
(R):5'- TGTCAGCCTGCAGTGACATC -3'
Posted On2016-06-06