Incidental Mutation 'R5011:Ivd'
ID390480
Institutional Source Beutler Lab
Gene Symbol Ivd
Ensembl Gene ENSMUSG00000027332
Gene Nameisovaleryl coenzyme A dehydrogenase
Synonyms
MMRRC Submission 042602-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118861954-118882909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118880465 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 385 (Y385C)
Ref Sequence ENSEMBL: ENSMUSP00000028807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028807]
Predicted Effect probably damaging
Transcript: ENSMUST00000028807
AA Change: Y385C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028807
Gene: ENSMUSG00000027332
AA Change: Y385C

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 44 158 9.4e-40 PFAM
Pfam:Acyl-CoA_dh_M 162 259 8.1e-31 PFAM
Pfam:Acyl-CoA_dh_1 271 419 2e-42 PFAM
Pfam:Acyl-CoA_dh_2 286 409 6.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154104
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atg16l1 C A 1: 87,774,180 S248* probably null Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
C3 T A 17: 57,223,236 Y455F probably benign Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Cops6 A G 5: 138,162,197 D102G probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Kcnn2 T A 18: 45,685,285 I483N possibly damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Mprip T C 11: 59,759,895 V1475A possibly damaging Het
Myh4 C A 11: 67,256,363 S1611R probably benign Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spink5 A T 18: 44,006,412 N614I probably damaging Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ttf2 T C 3: 100,963,169 E196G probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in Ivd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ivd APN 2 118876902 missense probably benign 0.06
IGL01122:Ivd APN 2 118876880 splice site probably benign
IGL01634:Ivd APN 2 118876382 missense probably damaging 1.00
IGL02178:Ivd APN 2 118871434 missense probably benign 0.00
IGL02478:Ivd APN 2 118862091 missense probably benign 0.21
IGL03104:Ivd APN 2 118872903 missense probably benign 0.01
R1335:Ivd UTSW 2 118869442 missense probably benign 0.00
R1823:Ivd UTSW 2 118862034 missense probably benign 0.05
R2008:Ivd UTSW 2 118871500 missense probably benign 0.00
R3162:Ivd UTSW 2 118862169 critical splice donor site probably null
R3162:Ivd UTSW 2 118862169 critical splice donor site probably null
R5013:Ivd UTSW 2 118880465 missense probably damaging 1.00
R5946:Ivd UTSW 2 118876889 missense possibly damaging 0.49
R6810:Ivd UTSW 2 118869761 missense probably benign
R7055:Ivd UTSW 2 118873249 missense probably damaging 0.99
R7131:Ivd UTSW 2 118869774 missense probably damaging 1.00
R7173:Ivd UTSW 2 118871389 missense probably damaging 1.00
R7302:Ivd UTSW 2 118871504 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTGGGATTTTGCCACACTG -3'
(R):5'- AAAGAAAGGCCTCTCGGTG -3'

Sequencing Primer
(F):5'- AACTCAGTGGTAGAGCATTTGCC -3'
(R):5'- TCTCGGTGCTGGGACCAG -3'
Posted On2016-06-06