Incidental Mutation 'R5011:Mprip'
ID390522
Institutional Source Beutler Lab
Gene Symbol Mprip
Ensembl Gene ENSMUSG00000005417
Gene Namemyosin phosphatase Rho interacting protein
Synonymsp116Rip, Rhoip3, RIP3, p116 Rho interacting protein
MMRRC Submission 042602-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59661305-59780860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59759895 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1475 (V1475A)
Ref Sequence ENSEMBL: ENSMUSP00000071081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066330
AA Change: V1475A

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417
AA Change: V1475A

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 249 320 1e-10 BLAST
PH 351 448 3.76e-18 SMART
low complexity region 492 501 N/A INTRINSIC
low complexity region 536 555 N/A INTRINSIC
coiled coil region 636 671 N/A INTRINSIC
Blast:PAC 806 848 2e-10 BLAST
low complexity region 1005 1023 N/A INTRINSIC
low complexity region 1047 1059 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1183 1200 N/A INTRINSIC
coiled coil region 1267 1300 N/A INTRINSIC
coiled coil region 1617 1642 N/A INTRINSIC
coiled coil region 1729 1779 N/A INTRINSIC
coiled coil region 1899 1936 N/A INTRINSIC
coiled coil region 1960 2110 N/A INTRINSIC
coiled coil region 2132 2206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072031
SMART Domains Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108751
SMART Domains Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 183 196 N/A INTRINSIC
Blast:PH 216 282 1e-10 BLAST
PH 349 446 3.76e-18 SMART
low complexity region 490 499 N/A INTRINSIC
low complexity region 534 553 N/A INTRINSIC
coiled coil region 634 669 N/A INTRINSIC
coiled coil region 690 840 N/A INTRINSIC
coiled coil region 862 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116371
SMART Domains Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132620
SMART Domains Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Blast:PH 101 167 9e-11 BLAST
PH 198 295 3.76e-18 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 383 402 N/A INTRINSIC
coiled coil region 482 517 N/A INTRINSIC
coiled coil region 538 688 N/A INTRINSIC
coiled coil region 710 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133861
SMART Domains Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
PH 373 470 3.76e-18 SMART
low complexity region 514 523 N/A INTRINSIC
low complexity region 558 577 N/A INTRINSIC
coiled coil region 658 693 N/A INTRINSIC
coiled coil region 714 864 N/A INTRINSIC
coiled coil region 886 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156111
SMART Domains Protein: ENSMUSP00000114446
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
internal_repeat_1 5 38 1.61e-7 PROSPERO
internal_repeat_2 9 51 2.4e-6 PROSPERO
internal_repeat_1 59 92 1.61e-7 PROSPERO
internal_repeat_2 85 129 2.4e-6 PROSPERO
coiled coil region 140 177 N/A INTRINSIC
coiled coil region 201 351 N/A INTRINSIC
coiled coil region 373 447 N/A INTRINSIC
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atg16l1 C A 1: 87,774,180 S248* probably null Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
C3 T A 17: 57,223,236 Y455F probably benign Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Cops6 A G 5: 138,162,197 D102G probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Kcnn2 T A 18: 45,685,285 I483N possibly damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Myh4 C A 11: 67,256,363 S1611R probably benign Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spink5 A T 18: 44,006,412 N614I probably damaging Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ttf2 T C 3: 100,963,169 E196G probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in Mprip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mprip APN 11 59748591 missense probably benign 0.07
IGL00563:Mprip APN 11 59752617 missense probably damaging 1.00
IGL00905:Mprip APN 11 59772168 missense possibly damaging 0.79
IGL00928:Mprip APN 11 59744752 missense probably damaging 1.00
IGL01161:Mprip APN 11 59731573 missense possibly damaging 0.93
IGL01991:Mprip APN 11 59755012 missense probably damaging 0.99
IGL02491:Mprip APN 11 59770031 missense probably benign 0.13
IGL03030:Mprip APN 11 59741115 splice site probably null
IGL03056:Mprip APN 11 59771692 missense probably damaging 1.00
IGL03293:Mprip APN 11 59696163 missense probably damaging 1.00
R0049:Mprip UTSW 11 59766745 missense probably damaging 0.99
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0147:Mprip UTSW 11 59737073 missense possibly damaging 0.68
R0319:Mprip UTSW 11 59697038 splice site probably benign
R0471:Mprip UTSW 11 59759735 missense probably damaging 1.00
R0539:Mprip UTSW 11 59741117 splice site probably benign
R0627:Mprip UTSW 11 59769972 missense probably damaging 1.00
R0864:Mprip UTSW 11 59758761 missense probably benign
R1218:Mprip UTSW 11 59743814 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1695:Mprip UTSW 11 59752531 missense probably damaging 0.99
R1698:Mprip UTSW 11 59760258 missense possibly damaging 0.75
R1802:Mprip UTSW 11 59755041 missense probably damaging 1.00
R1837:Mprip UTSW 11 59766745 missense probably damaging 0.99
R1862:Mprip UTSW 11 59758221 missense possibly damaging 0.90
R2094:Mprip UTSW 11 59749508 splice site probably benign
R2107:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2108:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2510:Mprip UTSW 11 59749508 splice site probably benign
R3003:Mprip UTSW 11 59727555 missense possibly damaging 0.95
R3115:Mprip UTSW 11 59765403 splice site probably null
R3941:Mprip UTSW 11 59731502 splice site probably benign
R4347:Mprip UTSW 11 59759453 missense possibly damaging 0.86
R4603:Mprip UTSW 11 59731573 missense probably damaging 1.00
R4807:Mprip UTSW 11 59758020 missense probably benign 0.00
R5338:Mprip UTSW 11 59760573 missense probably damaging 1.00
R5549:Mprip UTSW 11 59760818 missense probably benign 0.00
R5569:Mprip UTSW 11 59760963 missense probably damaging 1.00
R5604:Mprip UTSW 11 59758467 missense probably benign
R5615:Mprip UTSW 11 59758487 missense probably benign 0.08
R5846:Mprip UTSW 11 59758554 missense probably damaging 1.00
R5970:Mprip UTSW 11 59757721 missense probably damaging 0.96
R6054:Mprip UTSW 11 59758425 missense probably benign
R6452:Mprip UTSW 11 59752783 missense probably damaging 1.00
R6457:Mprip UTSW 11 59758989 missense possibly damaging 0.69
R6544:Mprip UTSW 11 59757726 missense probably benign 0.15
R6750:Mprip UTSW 11 59696131 missense probably damaging 1.00
R6843:Mprip UTSW 11 59759728 missense possibly damaging 0.54
R6851:Mprip UTSW 11 59759015 missense probably damaging 0.99
R6867:Mprip UTSW 11 59749630 critical splice donor site probably null
R7002:Mprip UTSW 11 59761190 missense probably benign 0.22
R7023:Mprip UTSW 11 59737389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGCTGCTTTCTGCTCAG -3'
(R):5'- GTCTCCTGTATGCTCTGCAG -3'

Sequencing Primer
(F):5'- GAAGCTGCTTTCTGCTCAGATAGTC -3'
(R):5'- GCAGCCTATGGTGGAACAATTCTC -3'
Posted On2016-06-06