Incidental Mutation 'R5011:Myh4'
ID390523
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Namemyosin, heavy polypeptide 4, skeletal muscle
SynonymsMM, Minimsc, MYH-2B, MyHC-IIb, Minmus, MHC2B, Myhsf
MMRRC Submission 042602-MU
Accession Numbers

Genbank: NM_010855; MGI: 1339713

Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67238029-67260446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67256363 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1611 (S1611R)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
Predicted Effect probably benign
Transcript: ENSMUST00000018632
AA Change: S1611R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: S1611R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170942
AA Change: S1611R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: S1611R

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atg16l1 C A 1: 87,774,180 S248* probably null Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
C3 T A 17: 57,223,236 Y455F probably benign Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Cops6 A G 5: 138,162,197 D102G probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Kcnn2 T A 18: 45,685,285 I483N possibly damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Mprip T C 11: 59,759,895 V1475A possibly damaging Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spink5 A T 18: 44,006,412 N614I probably damaging Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ttf2 T C 3: 100,963,169 E196G probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67255379 missense probably damaging 1.00
IGL01600:Myh4 APN 11 67260189 missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67243419 splice site probably benign
IGL02208:Myh4 APN 11 67251934 missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67245547 missense probably damaging 1.00
IGL02376:Myh4 APN 11 67245728 missense probably benign 0.00
IGL02429:Myh4 APN 11 67258982 nonsense probably null
IGL02450:Myh4 APN 11 67251809 missense probably damaging 1.00
IGL02524:Myh4 APN 11 67249240 missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67256479 missense probably benign
IGL03024:Myh4 APN 11 67248479 missense probably damaging 1.00
IGL03065:Myh4 APN 11 67259156 missense probably benign 0.12
IGL03084:Myh4 APN 11 67251951 splice site probably null
IGL03188:Myh4 APN 11 67246543 critical splice donor site probably null
IGL03204:Myh4 APN 11 67250296 missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67252216 missense probably damaging 0.99
IGL03345:Myh4 APN 11 67255478 missense probably damaging 1.00
F6893:Myh4 UTSW 11 67255457 missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67258832 missense probably benign 0.01
PIT4458001:Myh4 UTSW 11 67240995 missense possibly damaging 0.56
R0099:Myh4 UTSW 11 67259347 missense probably benign
R0194:Myh4 UTSW 11 67252336 missense probably damaging 1.00
R0346:Myh4 UTSW 11 67260326 missense probably benign
R0427:Myh4 UTSW 11 67258653 missense probably damaging 0.98
R0483:Myh4 UTSW 11 67252297 missense probably damaging 1.00
R0571:Myh4 UTSW 11 67250331 missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67259147 missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67242863 missense probably damaging 1.00
R0946:Myh4 UTSW 11 67251751 missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67255706 missense probably null 0.01
R1162:Myh4 UTSW 11 67258613 missense probably damaging 0.97
R1194:Myh4 UTSW 11 67255734 critical splice donor site probably null
R1347:Myh4 UTSW 11 67244741 splice site probably benign
R1457:Myh4 UTSW 11 67248461 missense probably damaging 0.99
R1531:Myh4 UTSW 11 67250540 missense probably benign 0.01
R1716:Myh4 UTSW 11 67250309 missense possibly damaging 0.92
R1766:Myh4 UTSW 11 67256295 missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67260324 missense probably benign
R1856:Myh4 UTSW 11 67255682 missense probably damaging 1.00
R1873:Myh4 UTSW 11 67254743 missense probably benign 0.16
R2069:Myh4 UTSW 11 67246366 splice site probably benign
R2370:Myh4 UTSW 11 67255628 missense probably damaging 1.00
R2406:Myh4 UTSW 11 67259174 missense probably damaging 1.00
R2414:Myh4 UTSW 11 67250768 missense probably benign 0.01
R2848:Myh4 UTSW 11 67248633 missense probably benign 0.20
R3111:Myh4 UTSW 11 67246450 missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67255315 missense probably damaging 1.00
R3845:Myh4 UTSW 11 67259105 missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67257183 missense probably benign 0.00
R4498:Myh4 UTSW 11 67251752 missense probably damaging 1.00
R4514:Myh4 UTSW 11 67255569 missense probably benign 0.06
R4601:Myh4 UTSW 11 67250310 missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67246401 missense probably benign 0.02
R4684:Myh4 UTSW 11 67245811 missense probably damaging 0.99
R4736:Myh4 UTSW 11 67240920 missense probably benign 0.01
R4837:Myh4 UTSW 11 67258992 missense probably benign 0.38
R4866:Myh4 UTSW 11 67248627 missense probably benign 0.00
R4869:Myh4 UTSW 11 67252664 missense probably damaging 1.00
R4887:Myh4 UTSW 11 67241054 missense probably damaging 0.99
R4921:Myh4 UTSW 11 67254028 missense probably damaging 1.00
R5005:Myh4 UTSW 11 67253415 missense probably benign 0.05
R5008:Myh4 UTSW 11 67253532 missense probably benign 0.00
R5087:Myh4 UTSW 11 67255409 missense probably damaging 1.00
R5277:Myh4 UTSW 11 67252354 missense probably damaging 1.00
R5336:Myh4 UTSW 11 67259191 splice site probably null
R5354:Myh4 UTSW 11 67255725 missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67259324 missense probably damaging 1.00
R5484:Myh4 UTSW 11 67251818 missense probably damaging 1.00
R5774:Myh4 UTSW 11 67253208 nonsense probably null
R5902:Myh4 UTSW 11 67250907 missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67259300 missense probably damaging 0.99
R6045:Myh4 UTSW 11 67244724 missense probably benign 0.32
R6156:Myh4 UTSW 11 67250792 missense probably benign 0.00
R6301:Myh4 UTSW 11 67255333 missense possibly damaging 0.95
R6318:Myh4 UTSW 11 67243442 missense probably benign 0.02
R6352:Myh4 UTSW 11 67252282 missense probably damaging 1.00
R6385:Myh4 UTSW 11 67255837 missense probably damaging 1.00
R6493:Myh4 UTSW 11 67258629 missense probably benign 0.16
R6666:Myh4 UTSW 11 67251812 missense probably damaging 1.00
R6826:Myh4 UTSW 11 67246531 missense probably damaging 1.00
R6852:Myh4 UTSW 11 67252968 splice site probably null
R6857:Myh4 UTSW 11 67249885 missense possibly damaging 0.74
R7029:Myh4 UTSW 11 67246425 missense probably benign 0.40
R7076:Myh4 UTSW 11 67253173 missense possibly damaging 0.85
R7145:Myh4 UTSW 11 67260228 missense possibly damaging 0.54
R7179:Myh4 UTSW 11 67244724 missense probably benign 0.32
R7365:Myh4 UTSW 11 67242848 missense probably damaging 1.00
X0027:Myh4 UTSW 11 67246480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTTGAGAAACCACCATAGTGAG -3'
(R):5'- AACACTGAGCCTGCTGACAC -3'

Sequencing Primer
(F):5'- GTGAGGTCACCAAAATGTTGC -3'
(R):5'- GCTGACACAGTGCATGTTCAC -3'
Posted On2016-06-06