Mutagenetix > Incidental Mutation

Incidental Mutation 'R5011:2700049A03Rik'

390528

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3, Ta3

MMRRC Submission

042602-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5011 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71183622-71290077 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 71211320 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 685 (E685*)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]

AlphaFold

E9PV87

Predicted Effect

probably null
Transcript: ENSMUST00000045907
AA Change: E685*

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: E685*

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000149564
AA Change: E685*

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: E685*

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (104/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810010H24Rik	T	C	11: 106,919,324 (GRCm39)	V223A	probably damaging	Het
Ahctf1	A	T	1: 179,611,675 (GRCm39)	I565N	possibly damaging	Het
Ank1	C	T	8: 23,572,300 (GRCm39)	T70I	probably damaging	Het
Atg16l1	C	A	1: 87,701,902 (GRCm39)	S248*	probably null	Het
Atp13a5	A	T	16: 29,169,566 (GRCm39)	L42Q	probably damaging	Het
Atxn1	T	C	13: 45,710,545 (GRCm39)	N796D	probably damaging	Het
C3	T	A	17: 57,530,236 (GRCm39)	Y455F	probably benign	Het
Card11	A	T	5: 140,862,275 (GRCm39)	D1007E	possibly damaging	Het
Cbr2	T	C	11: 120,621,697 (GRCm39)	D60G	possibly damaging	Het
Cgn	T	A	3: 94,683,455 (GRCm39)	E400V	probably null	Het
Chil3	T	A	3: 106,057,477 (GRCm39)	Y229F	possibly damaging	Het
Clcn2	G	A	16: 20,525,965 (GRCm39)	P785S	probably damaging	Het
Clk1	T	C	1: 58,453,642 (GRCm39)	I315V	probably benign	Het
Cops6	A	G	5: 138,160,459 (GRCm39)	D102G	probably benign	Het
Dennd5a	A	G	7: 109,513,983 (GRCm39)	I743T	possibly damaging	Het
Dnaaf5	T	A	5: 139,149,012 (GRCm39)	L437Q	probably damaging	Het
Dnah12	T	A	14: 26,431,326 (GRCm39)	D381E	probably benign	Het
Dnah8	G	A	17: 30,967,542 (GRCm39)	D2585N	probably benign	Het
Draxin	C	A	4: 148,192,436 (GRCm39)	R292L	probably damaging	Het
Dst	T	C	1: 34,289,728 (GRCm39)	V5776A	probably damaging	Het
Eddm13	G	A	7: 6,269,332 (GRCm39)		probably benign	Het
Ercc4	G	A	16: 12,941,445 (GRCm39)		probably benign	Het
Eya1	T	A	1: 14,254,582 (GRCm39)	N417Y	probably damaging	Het
Fam149b	T	A	14: 20,413,439 (GRCm39)	H219Q	possibly damaging	Het
Fam227b	G	A	2: 125,958,043 (GRCm39)	P241S	probably damaging	Het
Fat1	A	T	8: 45,484,300 (GRCm39)		probably null	Het
Fbxl18	A	G	5: 142,872,435 (GRCm39)	S267P	probably damaging	Het
Fer1l4	T	C	2: 155,873,135 (GRCm39)	Y1315C	probably damaging	Het
Fgd2	T	C	17: 29,593,954 (GRCm39)		probably null	Het
Gm7251	T	A	13: 49,958,656 (GRCm39)		noncoding transcript	Het
Golt1a	T	C	1: 133,248,006 (GRCm39)	V78A	probably damaging	Het
Gsn	T	A	2: 35,188,933 (GRCm39)	Y440N	probably damaging	Het
Gtf2ird2	G	T	5: 134,245,824 (GRCm39)	S694I	possibly damaging	Het
H2-Ob	T	A	17: 34,460,253 (GRCm39)		probably null	Het
Hsp90b1	T	C	10: 86,532,617 (GRCm39)	D353G	probably benign	Het
Ilk	A	G	7: 105,391,456 (GRCm39)	D374G	probably damaging	Het
Invs	G	A	4: 48,421,807 (GRCm39)	R813Q	probably damaging	Het
Itga7	G	A	10: 128,785,316 (GRCm39)	V836M	possibly damaging	Het
Itln1	T	A	1: 171,360,958 (GRCm39)	K45*	probably null	Het
Ivd	A	G	2: 118,710,946 (GRCm39)	Y385C	probably damaging	Het
Ivns1abp	T	A	1: 151,238,953 (GRCm39)	M589K	possibly damaging	Het
Jakmip3	C	T	7: 138,621,951 (GRCm39)	R284W	probably damaging	Het
Kank3	T	C	17: 34,041,044 (GRCm39)	L512P	probably damaging	Het
Kcnn2	T	A	18: 45,818,352 (GRCm39)	I483N	possibly damaging	Het
Klk1b4	A	G	7: 43,860,492 (GRCm39)	N170S	probably benign	Het
Klk1b9	A	C	7: 43,445,419 (GRCm39)	D203A	probably damaging	Het
Lbr	A	T	1: 181,647,453 (GRCm39)	Y199*	probably null	Het
Lcn6	T	A	2: 25,567,082 (GRCm39)		probably null	Het
Lrriq1	T	C	10: 103,025,784 (GRCm39)	D946G	probably damaging	Het
Ltbp1	T	A	17: 75,373,152 (GRCm39)	L265H	probably damaging	Het
Maml3	A	T	3: 51,598,196 (GRCm39)	N183K	possibly damaging	Het
Mprip	T	C	11: 59,650,721 (GRCm39)	V1475A	possibly damaging	Het
Myh4	C	A	11: 67,147,189 (GRCm39)	S1611R	probably benign	Het
Nagpa	A	T	16: 5,013,743 (GRCm39)	M365K	probably benign	Het
Nckap5l	G	T	15: 99,324,457 (GRCm39)	P682Q	probably benign	Het
Nudt12	T	C	17: 59,303,499 (GRCm39)		probably benign	Het
Nup153	T	C	13: 46,840,879 (GRCm39)	T910A	possibly damaging	Het
Or1e31	T	A	11: 73,690,473 (GRCm39)	T37S	possibly damaging	Het
Or5ae2	T	C	7: 84,505,646 (GRCm39)	V23A	probably damaging	Het
Or7c74	A	G	2: 37,160,937 (GRCm39)		noncoding transcript	Het
Or8k53	A	T	2: 86,177,647 (GRCm39)	F154L	probably benign	Het
Pate14	T	C	9: 36,549,120 (GRCm39)	N47D	probably benign	Het
Pbx2	T	A	17: 34,813,673 (GRCm39)	C224*	probably null	Het
Pcdha6	A	G	18: 37,100,960 (GRCm39)	D51G	probably damaging	Het
Pnpla1	C	T	17: 29,104,558 (GRCm39)	T538I	possibly damaging	Het
Pnpla2	T	C	7: 141,039,204 (GRCm39)		probably null	Het
Psme2b	C	T	11: 48,836,654 (GRCm39)	E98K	probably benign	Het
Ranbp2	T	A	10: 58,297,717 (GRCm39)	S375T	probably benign	Het
Rimbp2	T	C	5: 128,880,985 (GRCm39)	Y134C	probably damaging	Het
Ryr1	G	A	7: 28,802,234 (GRCm39)		probably null	Het
Sh3tc1	G	T	5: 35,857,633 (GRCm39)	A1185D	probably damaging	Het
Sin3b	G	A	8: 73,471,184 (GRCm39)	S377N	probably benign	Het
Slc28a2	T	C	2: 122,288,371 (GRCm39)	M554T	possibly damaging	Het
Snhg11	T	C	2: 158,218,872 (GRCm39)		probably benign	Het
Spink5	A	T	18: 44,139,479 (GRCm39)	N614I	probably damaging	Het
Tert	T	C	13: 73,794,428 (GRCm39)		probably null	Het
Thap4	T	C	1: 93,677,598 (GRCm39)	Y396C	probably damaging	Het
Tle2	T	C	10: 81,420,531 (GRCm39)	L348P	probably damaging	Het
Tmem104	T	C	11: 115,134,312 (GRCm39)	S283P	probably damaging	Het
Tnn	T	C	1: 159,953,949 (GRCm39)	E602G	possibly damaging	Het
Tpm4	A	G	8: 72,900,938 (GRCm39)	K190R	probably benign	Het
Ttf2	T	C	3: 100,870,485 (GRCm39)	E196G	probably benign	Het
Ugt3a1	T	C	15: 9,365,373 (GRCm39)	W329R	probably damaging	Het
Unc13a	G	A	8: 72,094,121 (GRCm39)	Q1327*	probably null	Het
Vmn1r194	C	T	13: 22,429,058 (GRCm39)	T225I	probably benign	Het
Vmn1r215	T	C	13: 23,260,721 (GRCm39)	S254P	probably damaging	Het
Vmn2r109	T	C	17: 20,775,451 (GRCm39)	E92G	probably damaging	Het
Ythdc2	A	G	18: 44,987,809 (GRCm39)	M625V	probably benign	Het
Zfp106	A	G	2: 120,341,015 (GRCm39)	W1832R	probably damaging	Het
Zfp189	G	A	4: 49,530,438 (GRCm39)	G514S	probably damaging	Het
Zfp768	T	C	7: 126,942,875 (GRCm39)	R418G	probably damaging	Het
Zmynd11	C	T	13: 9,739,479 (GRCm39)		probably benign	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71,213,893 (GRCm39)	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71,241,242 (GRCm39)	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71,211,152 (GRCm39)	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71,213,957 (GRCm39)	missense	probably benign	0.00
IGL01835:2700049A03Rik	APN	12	71,213,955 (GRCm39)	nonsense	probably null
IGL02122:2700049A03Rik	APN	12	71,217,299 (GRCm39)	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71,195,034 (GRCm39)	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71,201,630 (GRCm39)	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71,240,147 (GRCm39)	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71,187,657 (GRCm39)	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71,205,599 (GRCm39)	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71,184,683 (GRCm39)	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71,207,160 (GRCm39)	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71,217,440 (GRCm39)	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71,224,692 (GRCm39)	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71,213,924 (GRCm39)	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71,195,194 (GRCm39)	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71,184,804 (GRCm39)	missense	possibly damaging	0.96
R0468:2700049A03Rik	UTSW	12	71,240,084 (GRCm39)	missense	possibly damaging	0.71
R0508:2700049A03Rik	UTSW	12	71,211,162 (GRCm39)	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71,224,642 (GRCm39)	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71,205,657 (GRCm39)	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71,266,082 (GRCm39)	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71,262,918 (GRCm39)	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71,217,361 (GRCm39)	splice site	probably null
R1599:2700049A03Rik	UTSW	12	71,197,033 (GRCm39)	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71,265,995 (GRCm39)	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71,197,018 (GRCm39)	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71,207,186 (GRCm39)	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71,235,393 (GRCm39)	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2337:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2512:2700049A03Rik	UTSW	12	71,219,945 (GRCm39)	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71,201,530 (GRCm39)	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3236:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3960:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71,195,037 (GRCm39)	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4651:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4735:2700049A03Rik	UTSW	12	71,262,897 (GRCm39)	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71,236,216 (GRCm39)	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4852:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4884:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71,236,420 (GRCm39)	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71,289,799 (GRCm39)	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,240,123 (GRCm39)	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71,235,565 (GRCm39)	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71,289,801 (GRCm39)	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5502:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5503:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5725:2700049A03Rik	UTSW	12	71,240,093 (GRCm39)	missense	probably benign	0.05
R5956:2700049A03Rik	UTSW	12	71,203,893 (GRCm39)	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71,231,304 (GRCm39)	missense	possibly damaging	0.84
R6148:2700049A03Rik	UTSW	12	71,234,200 (GRCm39)	missense	possibly damaging	0.71
R6158:2700049A03Rik	UTSW	12	71,217,410 (GRCm39)	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71,211,318 (GRCm39)	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71,263,004 (GRCm39)	splice site	probably null
R7168:2700049A03Rik	UTSW	12	71,262,831 (GRCm39)	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71,265,963 (GRCm39)	critical splice acceptor site	probably null
R7200:2700049A03Rik	UTSW	12	71,187,680 (GRCm39)	missense	probably damaging	0.96
R7359:2700049A03Rik	UTSW	12	71,236,348 (GRCm39)	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71,197,179 (GRCm39)	missense	possibly damaging	0.67
R7755:2700049A03Rik	UTSW	12	71,236,187 (GRCm39)	missense	probably benign	0.02
R7757:2700049A03Rik	UTSW	12	71,236,187 (GRCm39)	missense	probably benign	0.02
R7922:2700049A03Rik	UTSW	12	71,211,180 (GRCm39)	missense	possibly damaging	0.83
R7966:2700049A03Rik	UTSW	12	71,219,903 (GRCm39)	missense	probably benign	0.00
R8082:2700049A03Rik	UTSW	12	71,188,895 (GRCm39)	critical splice donor site	probably null
R8311:2700049A03Rik	UTSW	12	71,184,815 (GRCm39)	unclassified	probably benign
R8408:2700049A03Rik	UTSW	12	71,236,356 (GRCm39)	missense	possibly damaging	0.71
R8852:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R8860:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R9039:2700049A03Rik	UTSW	12	71,213,849 (GRCm39)	missense	possibly damaging	0.51
R9281:2700049A03Rik	UTSW	12	71,205,687 (GRCm39)	missense	possibly damaging	0.51
R9308:2700049A03Rik	UTSW	12	71,231,233 (GRCm39)	missense	probably benign	0.23
R9385:2700049A03Rik	UTSW	12	71,207,966 (GRCm39)	missense	possibly damaging	0.52
R9412:2700049A03Rik	UTSW	12	71,235,457 (GRCm39)	missense	possibly damaging	0.71
R9643:2700049A03Rik	UTSW	12	71,211,189 (GRCm39)	missense	possibly damaging	0.92
R9676:2700049A03Rik	UTSW	12	71,207,905 (GRCm39)	missense	possibly damaging	0.86
R9776:2700049A03Rik	UTSW	12	71,235,448 (GRCm39)	missense	possibly damaging	0.71
R9789:2700049A03Rik	UTSW	12	71,231,357 (GRCm39)	missense	probably benign
Z1177:2700049A03Rik	UTSW	12	71,211,258 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACCTTTTATGTTTCCTAGGTGG -3'
(R):5'- CCACAAACACTGTTCCCTGG -3'

Sequencing Primer
(F):5'- AACATGTTTTGCATTGGTAGGGCC -3'
(R):5'- TTCCCTGGCAGATAACGGTACTG -3'

Posted On

2016-06-06