Incidental Mutation 'R5011:2700049A03Rik'
ID 390529
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene Name RIKEN cDNA 2700049A03 gene
Synonyms talpid3, Ta3
MMRRC Submission 042602-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5011 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 71183622-71290077 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71211321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 685 (E685V)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
AlphaFold E9PV87
Predicted Effect possibly damaging
Transcript: ENSMUST00000045907
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: E685V

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149564
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: E685V

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Meta Mutation Damage Score 0.1812 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 106,919,324 (GRCm39) V223A probably damaging Het
Ahctf1 A T 1: 179,611,675 (GRCm39) I565N possibly damaging Het
Ank1 C T 8: 23,572,300 (GRCm39) T70I probably damaging Het
Atg16l1 C A 1: 87,701,902 (GRCm39) S248* probably null Het
Atp13a5 A T 16: 29,169,566 (GRCm39) L42Q probably damaging Het
Atxn1 T C 13: 45,710,545 (GRCm39) N796D probably damaging Het
C3 T A 17: 57,530,236 (GRCm39) Y455F probably benign Het
Card11 A T 5: 140,862,275 (GRCm39) D1007E possibly damaging Het
Cbr2 T C 11: 120,621,697 (GRCm39) D60G possibly damaging Het
Cgn T A 3: 94,683,455 (GRCm39) E400V probably null Het
Chil3 T A 3: 106,057,477 (GRCm39) Y229F possibly damaging Het
Clcn2 G A 16: 20,525,965 (GRCm39) P785S probably damaging Het
Clk1 T C 1: 58,453,642 (GRCm39) I315V probably benign Het
Cops6 A G 5: 138,160,459 (GRCm39) D102G probably benign Het
Dennd5a A G 7: 109,513,983 (GRCm39) I743T possibly damaging Het
Dnaaf5 T A 5: 139,149,012 (GRCm39) L437Q probably damaging Het
Dnah12 T A 14: 26,431,326 (GRCm39) D381E probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Draxin C A 4: 148,192,436 (GRCm39) R292L probably damaging Het
Dst T C 1: 34,289,728 (GRCm39) V5776A probably damaging Het
Eddm13 G A 7: 6,269,332 (GRCm39) probably benign Het
Ercc4 G A 16: 12,941,445 (GRCm39) probably benign Het
Eya1 T A 1: 14,254,582 (GRCm39) N417Y probably damaging Het
Fam149b T A 14: 20,413,439 (GRCm39) H219Q possibly damaging Het
Fam227b G A 2: 125,958,043 (GRCm39) P241S probably damaging Het
Fat1 A T 8: 45,484,300 (GRCm39) probably null Het
Fbxl18 A G 5: 142,872,435 (GRCm39) S267P probably damaging Het
Fer1l4 T C 2: 155,873,135 (GRCm39) Y1315C probably damaging Het
Fgd2 T C 17: 29,593,954 (GRCm39) probably null Het
Gm7251 T A 13: 49,958,656 (GRCm39) noncoding transcript Het
Golt1a T C 1: 133,248,006 (GRCm39) V78A probably damaging Het
Gsn T A 2: 35,188,933 (GRCm39) Y440N probably damaging Het
Gtf2ird2 G T 5: 134,245,824 (GRCm39) S694I possibly damaging Het
H2-Ob T A 17: 34,460,253 (GRCm39) probably null Het
Hsp90b1 T C 10: 86,532,617 (GRCm39) D353G probably benign Het
Ilk A G 7: 105,391,456 (GRCm39) D374G probably damaging Het
Invs G A 4: 48,421,807 (GRCm39) R813Q probably damaging Het
Itga7 G A 10: 128,785,316 (GRCm39) V836M possibly damaging Het
Itln1 T A 1: 171,360,958 (GRCm39) K45* probably null Het
Ivd A G 2: 118,710,946 (GRCm39) Y385C probably damaging Het
Ivns1abp T A 1: 151,238,953 (GRCm39) M589K possibly damaging Het
Jakmip3 C T 7: 138,621,951 (GRCm39) R284W probably damaging Het
Kank3 T C 17: 34,041,044 (GRCm39) L512P probably damaging Het
Kcnn2 T A 18: 45,818,352 (GRCm39) I483N possibly damaging Het
Klk1b4 A G 7: 43,860,492 (GRCm39) N170S probably benign Het
Klk1b9 A C 7: 43,445,419 (GRCm39) D203A probably damaging Het
Lbr A T 1: 181,647,453 (GRCm39) Y199* probably null Het
Lcn6 T A 2: 25,567,082 (GRCm39) probably null Het
Lrriq1 T C 10: 103,025,784 (GRCm39) D946G probably damaging Het
Ltbp1 T A 17: 75,373,152 (GRCm39) L265H probably damaging Het
Maml3 A T 3: 51,598,196 (GRCm39) N183K possibly damaging Het
Mprip T C 11: 59,650,721 (GRCm39) V1475A possibly damaging Het
Myh4 C A 11: 67,147,189 (GRCm39) S1611R probably benign Het
Nagpa A T 16: 5,013,743 (GRCm39) M365K probably benign Het
Nckap5l G T 15: 99,324,457 (GRCm39) P682Q probably benign Het
Nudt12 T C 17: 59,303,499 (GRCm39) probably benign Het
Nup153 T C 13: 46,840,879 (GRCm39) T910A possibly damaging Het
Or1e31 T A 11: 73,690,473 (GRCm39) T37S possibly damaging Het
Or5ae2 T C 7: 84,505,646 (GRCm39) V23A probably damaging Het
Or7c74 A G 2: 37,160,937 (GRCm39) noncoding transcript Het
Or8k53 A T 2: 86,177,647 (GRCm39) F154L probably benign Het
Pate14 T C 9: 36,549,120 (GRCm39) N47D probably benign Het
Pbx2 T A 17: 34,813,673 (GRCm39) C224* probably null Het
Pcdha6 A G 18: 37,100,960 (GRCm39) D51G probably damaging Het
Pnpla1 C T 17: 29,104,558 (GRCm39) T538I possibly damaging Het
Pnpla2 T C 7: 141,039,204 (GRCm39) probably null Het
Psme2b C T 11: 48,836,654 (GRCm39) E98K probably benign Het
Ranbp2 T A 10: 58,297,717 (GRCm39) S375T probably benign Het
Rimbp2 T C 5: 128,880,985 (GRCm39) Y134C probably damaging Het
Ryr1 G A 7: 28,802,234 (GRCm39) probably null Het
Sh3tc1 G T 5: 35,857,633 (GRCm39) A1185D probably damaging Het
Sin3b G A 8: 73,471,184 (GRCm39) S377N probably benign Het
Slc28a2 T C 2: 122,288,371 (GRCm39) M554T possibly damaging Het
Snhg11 T C 2: 158,218,872 (GRCm39) probably benign Het
Spink5 A T 18: 44,139,479 (GRCm39) N614I probably damaging Het
Tert T C 13: 73,794,428 (GRCm39) probably null Het
Thap4 T C 1: 93,677,598 (GRCm39) Y396C probably damaging Het
Tle2 T C 10: 81,420,531 (GRCm39) L348P probably damaging Het
Tmem104 T C 11: 115,134,312 (GRCm39) S283P probably damaging Het
Tnn T C 1: 159,953,949 (GRCm39) E602G possibly damaging Het
Tpm4 A G 8: 72,900,938 (GRCm39) K190R probably benign Het
Ttf2 T C 3: 100,870,485 (GRCm39) E196G probably benign Het
Ugt3a1 T C 15: 9,365,373 (GRCm39) W329R probably damaging Het
Unc13a G A 8: 72,094,121 (GRCm39) Q1327* probably null Het
Vmn1r194 C T 13: 22,429,058 (GRCm39) T225I probably benign Het
Vmn1r215 T C 13: 23,260,721 (GRCm39) S254P probably damaging Het
Vmn2r109 T C 17: 20,775,451 (GRCm39) E92G probably damaging Het
Ythdc2 A G 18: 44,987,809 (GRCm39) M625V probably benign Het
Zfp106 A G 2: 120,341,015 (GRCm39) W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 (GRCm39) G514S probably damaging Het
Zfp768 T C 7: 126,942,875 (GRCm39) R418G probably damaging Het
Zmynd11 C T 13: 9,739,479 (GRCm39) probably benign Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71,213,893 (GRCm39) missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71,241,242 (GRCm39) critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71,211,152 (GRCm39) splice site probably null
IGL01835:2700049A03Rik APN 12 71,213,957 (GRCm39) missense probably benign 0.00
IGL01835:2700049A03Rik APN 12 71,213,955 (GRCm39) nonsense probably null
IGL02122:2700049A03Rik APN 12 71,217,299 (GRCm39) missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71,195,034 (GRCm39) missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71,201,630 (GRCm39) missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71,240,147 (GRCm39) missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71,187,657 (GRCm39) missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71,205,599 (GRCm39) splice site probably benign
G4846:2700049A03Rik UTSW 12 71,184,683 (GRCm39) missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71,207,160 (GRCm39) missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71,217,440 (GRCm39) missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71,224,692 (GRCm39) missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71,213,924 (GRCm39) missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71,195,194 (GRCm39) critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71,184,804 (GRCm39) missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71,240,084 (GRCm39) missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71,211,162 (GRCm39) missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71,224,642 (GRCm39) missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71,205,657 (GRCm39) missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71,266,082 (GRCm39) splice site probably benign
R1244:2700049A03Rik UTSW 12 71,262,918 (GRCm39) missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71,217,361 (GRCm39) splice site probably null
R1599:2700049A03Rik UTSW 12 71,197,033 (GRCm39) missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71,265,995 (GRCm39) missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71,197,018 (GRCm39) missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71,207,186 (GRCm39) splice site probably null
R1998:2700049A03Rik UTSW 12 71,235,393 (GRCm39) missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2337:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2340:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2382:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2384:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2445:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2449:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2512:2700049A03Rik UTSW 12 71,219,945 (GRCm39) missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71,201,530 (GRCm39) splice site probably benign
R3236:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3236:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3237:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3734:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3809:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3944:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3960:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4593:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4595:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4596:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71,195,037 (GRCm39) missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4649:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4651:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4714:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4735:2700049A03Rik UTSW 12 71,262,897 (GRCm39) missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71,236,216 (GRCm39) missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4852:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4854:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4855:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4855:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4884:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4884:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4893:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4905:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71,236,420 (GRCm39) missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4919:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4989:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5012:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5012:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5118:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71,289,799 (GRCm39) missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5163:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5188:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5189:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71,240,123 (GRCm39) missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5190:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71,235,565 (GRCm39) missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71,289,801 (GRCm39) missense probably benign
R5502:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5502:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5503:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5619:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5667:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5669:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5671:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5671:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71,240,093 (GRCm39) missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71,203,893 (GRCm39) missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71,231,304 (GRCm39) missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71,234,200 (GRCm39) missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71,217,410 (GRCm39) missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71,211,318 (GRCm39) missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71,263,004 (GRCm39) splice site probably null
R7168:2700049A03Rik UTSW 12 71,262,831 (GRCm39) missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71,265,963 (GRCm39) critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71,187,680 (GRCm39) missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71,236,348 (GRCm39) missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71,197,179 (GRCm39) missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7922:2700049A03Rik UTSW 12 71,211,180 (GRCm39) missense possibly damaging 0.83
R7966:2700049A03Rik UTSW 12 71,219,903 (GRCm39) missense probably benign 0.00
R8082:2700049A03Rik UTSW 12 71,188,895 (GRCm39) critical splice donor site probably null
R8311:2700049A03Rik UTSW 12 71,184,815 (GRCm39) unclassified probably benign
R8408:2700049A03Rik UTSW 12 71,236,356 (GRCm39) missense possibly damaging 0.71
R8852:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R8860:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R9039:2700049A03Rik UTSW 12 71,213,849 (GRCm39) missense possibly damaging 0.51
R9281:2700049A03Rik UTSW 12 71,205,687 (GRCm39) missense possibly damaging 0.51
R9308:2700049A03Rik UTSW 12 71,231,233 (GRCm39) missense probably benign 0.23
R9385:2700049A03Rik UTSW 12 71,207,966 (GRCm39) missense possibly damaging 0.52
R9412:2700049A03Rik UTSW 12 71,235,457 (GRCm39) missense possibly damaging 0.71
R9643:2700049A03Rik UTSW 12 71,211,189 (GRCm39) missense possibly damaging 0.92
R9676:2700049A03Rik UTSW 12 71,207,905 (GRCm39) missense possibly damaging 0.86
R9776:2700049A03Rik UTSW 12 71,235,448 (GRCm39) missense possibly damaging 0.71
R9789:2700049A03Rik UTSW 12 71,231,357 (GRCm39) missense probably benign
Z1177:2700049A03Rik UTSW 12 71,211,258 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCTTTTATGTTTCCTAGGTGG -3'
(R):5'- CTGTTCCCTGGCAGATAACG -3'

Sequencing Primer
(F):5'- AACATGTTTTGCATTGGTAGGGCC -3'
(R):5'- TAACGGTACTGAAGCTCTGC -3'
Posted On 2016-06-06