Incidental Mutation 'R5011:Kcnn2'
ID390558
Institutional Source Beutler Lab
Gene Symbol Kcnn2
Ensembl Gene ENSMUSG00000054477
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Synonymsfri, SK2, small conductance calcium-activated potassium channel 2, bc
MMRRC Submission 042602-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5011 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location45268860-45686024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45685285 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 483 (I483N)
Ref Sequence ENSEMBL: ENSMUSP00000148153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066890] [ENSMUST00000169783] [ENSMUST00000183850] [ENSMUST00000211323]
Predicted Effect probably benign
Transcript: ENSMUST00000066890
AA Change: I748N

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067884
Gene: ENSMUSG00000054477
AA Change: I748N

DomainStartEndE-ValueType
low complexity region 62 76 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
low complexity region 158 180 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 219 254 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 301 326 N/A INTRINSIC
low complexity region 345 373 N/A INTRINSIC
Pfam:SK_channel 380 493 2.2e-51 PFAM
transmembrane domain 516 535 N/A INTRINSIC
Pfam:Ion_trans_2 572 658 2.2e-14 PFAM
CaMBD 672 748 6.51e-51 SMART
coiled coil region 751 784 N/A INTRINSIC
low complexity region 815 839 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169783
AA Change: I343N

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129659
Gene: ENSMUSG00000054477
AA Change: I343N

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
low complexity region 80 108 N/A INTRINSIC
Pfam:SK_channel 115 215 1.4e-36 PFAM
Pfam:Ion_trans_2 169 254 9.5e-15 PFAM
CaMBD 267 343 6.51e-51 SMART
coiled coil region 346 379 N/A INTRINSIC
low complexity region 410 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183850
AA Change: I483N

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139350
Gene: ENSMUSG00000054477
AA Change: I483N

DomainStartEndE-ValueType
low complexity region 62 76 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
low complexity region 158 180 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 219 254 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 301 326 N/A INTRINSIC
low complexity region 345 373 N/A INTRINSIC
Pfam:SK_channel 380 498 2.9e-60 PFAM
transmembrane domain 516 535 N/A INTRINSIC
Pfam:Ion_trans_2 573 659 1.8e-14 PFAM
CaMBD 672 748 6.51e-51 SMART
coiled coil region 751 784 N/A INTRINSIC
low complexity region 815 839 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184994
Predicted Effect possibly damaging
Transcript: ENSMUST00000211323
AA Change: I483N

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (104/104)
MGI Phenotype PHENOTYPE: Mice homozygous for a point mutation exhibit tremor and gait abnormalities. Homozygous null mice lack the apamin sensitive component of the medium afterhyperpolarization current but have normal hippocampal morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,498 V223A probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Atg16l1 C A 1: 87,774,180 S248* probably null Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Atxn1 T C 13: 45,557,069 N796D probably damaging Het
C3 T A 17: 57,223,236 Y455F probably benign Het
Card11 A T 5: 140,876,520 D1007E possibly damaging Het
Cbr2 T C 11: 120,730,871 D60G possibly damaging Het
Cgn T A 3: 94,776,145 E400V probably null Het
Chil3 T A 3: 106,150,161 Y229F possibly damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Clk1 T C 1: 58,414,483 I315V probably benign Het
Cops6 A G 5: 138,162,197 D102G probably benign Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnaaf5 T A 5: 139,163,257 L437Q probably damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Draxin C A 4: 148,107,979 R292L probably damaging Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fat1 A T 8: 45,031,263 probably null Het
Fbxl18 A G 5: 142,886,680 S267P probably damaging Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Fgd2 T C 17: 29,374,980 probably null Het
Gm7251 T A 13: 49,805,180 noncoding transcript Het
Golt1a T C 1: 133,320,268 V78A probably damaging Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Gtf2ird2 G T 5: 134,216,982 S694I possibly damaging Het
H2-Ob T A 17: 34,241,279 probably null Het
Hsp90b1 T C 10: 86,696,753 D353G probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itga7 G A 10: 128,949,447 V836M possibly damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Ivns1abp T A 1: 151,363,202 M589K possibly damaging Het
Jakmip3 C T 7: 139,020,222 R284W probably damaging Het
Kank3 T C 17: 33,822,070 L512P probably damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lbr A T 1: 181,819,888 Y199* probably null Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Ltbp1 T A 17: 75,066,157 L265H probably damaging Het
Maml3 A T 3: 51,690,775 N183K possibly damaging Het
Mprip T C 11: 59,759,895 V1475A possibly damaging Het
Myh4 C A 11: 67,256,363 S1611R probably benign Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nudt12 T C 17: 58,996,504 probably benign Het
Nup153 T C 13: 46,687,403 T910A possibly damaging Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Olfr391-ps T A 11: 73,799,647 T37S possibly damaging Het
Pbx2 T A 17: 34,594,699 C224* probably null Het
Pcdha6 A G 18: 36,967,907 D51G probably damaging Het
Pnpla1 C T 17: 28,885,584 T538I possibly damaging Het
Pnpla2 T C 7: 141,459,291 probably null Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ranbp2 T A 10: 58,461,895 S375T probably benign Het
Rimbp2 T C 5: 128,803,921 Y134C probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Sh3tc1 G T 5: 35,700,289 A1185D probably damaging Het
Sin3b G A 8: 72,744,556 S377N probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spink5 A T 18: 44,006,412 N614I probably damaging Het
Tert T C 13: 73,646,309 probably null Het
Thap4 T C 1: 93,749,876 Y396C probably damaging Het
Tle2 T C 10: 81,584,697 L348P probably damaging Het
Tmem104 T C 11: 115,243,486 S283P probably damaging Het
Tnn T C 1: 160,126,379 E602G possibly damaging Het
Tpm4 A G 8: 72,147,094 K190R probably benign Het
Ttf2 T C 3: 100,963,169 E196G probably benign Het
Ugt3a2 T C 15: 9,365,287 W329R probably damaging Het
Unc13a G A 8: 71,641,477 Q1327* probably null Het
Vmn1r194 C T 13: 22,244,888 T225I probably benign Het
Vmn1r215 T C 13: 23,076,551 S254P probably damaging Het
Vmn2r109 T C 17: 20,555,189 E92G probably damaging Het
Ythdc2 A G 18: 44,854,742 M625V probably benign Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zfp768 T C 7: 127,343,703 R418G probably damaging Het
Zmynd11 C T 13: 9,689,443 probably benign Het
Other mutations in Kcnn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kcnn2 APN 18 45592236 missense probably damaging 0.98
IGL00341:Kcnn2 APN 18 45677071 splice site probably benign
IGL01317:Kcnn2 APN 18 45560627 splice site probably null
IGL02121:Kcnn2 APN 18 45561273 missense probably damaging 0.98
IGL02561:Kcnn2 APN 18 45592192 missense possibly damaging 0.59
IGL03000:Kcnn2 APN 18 45560568 missense probably damaging 0.97
IGL03116:Kcnn2 APN 18 45655206 missense probably damaging 1.00
IGL03155:Kcnn2 APN 18 45685315 missense probably damaging 0.99
IGL03289:Kcnn2 APN 18 45677044 missense probably damaging 1.00
IGL03343:Kcnn2 APN 18 45676959 missense probably damaging 0.97
jitter UTSW 18 45561253 synonymous silent
I2288:Kcnn2 UTSW 18 45675273 intron probably benign
R0256:Kcnn2 UTSW 18 45592405 missense probably damaging 0.98
R0310:Kcnn2 UTSW 18 45560518 missense probably damaging 1.00
R0464:Kcnn2 UTSW 18 45560359 missense probably damaging 0.99
R0468:Kcnn2 UTSW 18 45559471 missense possibly damaging 0.96
R0485:Kcnn2 UTSW 18 45560148 missense probably benign 0.06
R0722:Kcnn2 UTSW 18 45559476 missense possibly damaging 0.73
R0898:Kcnn2 UTSW 18 45559476 missense possibly damaging 0.73
R1567:Kcnn2 UTSW 18 45670334 splice site probably null
R4543:Kcnn2 UTSW 18 45559648 missense probably benign 0.00
R4720:Kcnn2 UTSW 18 45683120 missense possibly damaging 0.78
R4732:Kcnn2 UTSW 18 45560349 missense possibly damaging 0.94
R4733:Kcnn2 UTSW 18 45560349 missense possibly damaging 0.94
R4801:Kcnn2 UTSW 18 45685267 splice site probably benign
R4844:Kcnn2 UTSW 18 45683120 missense possibly damaging 0.78
R4927:Kcnn2 UTSW 18 45559731 missense probably benign 0.01
R5108:Kcnn2 UTSW 18 45592055 missense probably damaging 0.99
R5805:Kcnn2 UTSW 18 45683131 missense probably damaging 0.98
R5841:Kcnn2 UTSW 18 45559396 missense probably benign
R5888:Kcnn2 UTSW 18 45592345 missense probably damaging 0.98
R5926:Kcnn2 UTSW 18 45685284 missense probably benign 0.01
R6552:Kcnn2 UTSW 18 45560098 missense probably benign 0.00
R6882:Kcnn2 UTSW 18 45559438 missense possibly damaging 0.53
R6999:Kcnn2 UTSW 18 45592377 missense probably damaging 0.99
R7324:Kcnn2 UTSW 18 45560071 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGGATGTAGATACTCGGGATG -3'
(R):5'- CGCTCAGCATTGTAGGAGACATG -3'

Sequencing Primer
(F):5'- TGTAGATACTCGGGATGTAGATACAC -3'
(R):5'- GACATGCTTGTCGTAGTTCTCC -3'
Posted On2016-06-06