Incidental Mutation 'R5012:1810055G02Rik'
List |< first << previous [record 58 of 18487] next >> last >|
ID390598
Institutional Source Beutler Lab
Gene Symbol 1810055G02Rik
Ensembl Gene ENSMUSG00000035372
Gene NameRIKEN cDNA 1810055G02 gene
Synonyms
MMRRC Submission 042603-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5012 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3708333-3717881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3717217 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 268 (T268K)
Ref Sequence ENSEMBL: ENSMUSP00000047063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039048]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039048
AA Change: T268K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047063
Gene: ENSMUSG00000035372
AA Change: T268K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
low complexity region 265 288 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Acsl1 A G 8: 46,521,431 S314G probably benign Het
Aftph G A 11: 20,698,264 probably benign Het
Ankrd34c T G 9: 89,729,656 I211L probably benign Het
Anks1b A G 10: 90,359,137 T560A probably benign Het
Carmil1 G T 13: 24,024,420 S1247R possibly damaging Het
Elf1 T A 14: 79,570,734 Y172N probably damaging Het
Emx1 C T 6: 85,203,973 P224L probably benign Het
Fastkd2 A T 1: 63,749,896 probably benign Het
Fbxw27 C A 9: 109,773,203 C234F probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Igkv6-23 C A 6: 70,260,545 A71S probably damaging Het
Igsf10 A G 3: 59,318,722 L2510P probably damaging Het
Itgal T C 7: 127,299,630 probably null Het
Kmt2c C A 5: 25,299,712 G122* probably null Het
Lamtor2 C T 3: 88,552,856 R3H possibly damaging Het
Magi2 A T 5: 20,465,620 T321S probably damaging Het
Mau2 A G 8: 70,031,457 probably null Het
Mcm7 A T 5: 138,169,347 probably null Het
Mitd1 A T 1: 37,885,293 C59S probably benign Het
Muc6 A G 7: 141,636,657 L2636P possibly damaging Het
Paip1 A G 13: 119,447,802 M233V probably benign Het
Pcdhb11 C A 18: 37,422,976 T453N possibly damaging Het
Plcb1 A G 2: 135,333,400 N545S probably null Het
Prl8a9 A T 13: 27,562,611 probably null Het
Psmc2 A G 5: 21,802,565 T308A probably benign Het
Rassf2 C A 2: 132,009,690 R44L probably damaging Het
Scn11a A T 9: 119,780,878 M968K probably benign Het
Sept4 T A 11: 87,584,404 S146T possibly damaging Het
Slc41a2 A G 10: 83,301,263 I260T probably benign Het
Steap2 G C 5: 5,677,784 L184V possibly damaging Het
Ttll5 G A 12: 85,926,844 E776K possibly damaging Het
Vipr1 A T 9: 121,658,045 probably null Het
Yars2 T C 16: 16,303,584 S201P probably damaging Het
Zfp386 T A 12: 116,059,244 I194K probably benign Het
Zfp988 A G 4: 147,331,603 I165V probably benign Het
Other mutations in 1810055G02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:1810055G02Rik APN 19 3717040 missense probably benign 0.02
IGL02883:1810055G02Rik APN 19 3716972 missense possibly damaging 0.83
R0909:1810055G02Rik UTSW 19 3715788 missense probably benign 0.00
R1482:1810055G02Rik UTSW 19 3717192 missense probably benign 0.01
R2158:1810055G02Rik UTSW 19 3716608 missense possibly damaging 0.46
R4833:1810055G02Rik UTSW 19 3716872 missense possibly damaging 0.87
R5557:1810055G02Rik UTSW 19 3717501 missense possibly damaging 0.66
X0026:1810055G02Rik UTSW 19 3716826 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGGTGCCCAAATACAAGG -3'
(R):5'- CAATGGTGACTAGGTACTGGC -3'

Sequencing Primer
(F):5'- AAGGTACCACCGTCCAGCTG -3'
(R):5'- ACTAGGTACTGGCCTTGGG -3'
Posted On2016-06-06