Incidental Mutation 'R5013:Eya1'
ID390599
Institutional Source Beutler Lab
Gene Symbol Eya1
Ensembl Gene ENSMUSG00000025932
Gene NameEYA transcriptional coactivator and phosphatase 1
Synonymsbor
MMRRC Submission 042604-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R5013 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location14168954-14310235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14184358 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 417 (N417Y)
Ref Sequence ENSEMBL: ENSMUSP00000079493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027066] [ENSMUST00000080664] [ENSMUST00000168081] [ENSMUST00000190337]
Predicted Effect probably damaging
Transcript: ENSMUST00000027066
AA Change: N450Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027066
Gene: ENSMUSG00000025932
AA Change: N450Y

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000080664
AA Change: N417Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079493
Gene: ENSMUSG00000025932
AA Change: N417Y

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 256 280 N/A INTRINSIC
PDB:3HB1|D 281 552 1e-173 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000168081
AA Change: N446Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126383
Gene: ENSMUSG00000025932
AA Change: N446Y

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 207 219 N/A INTRINSIC
low complexity region 262 286 N/A INTRINSIC
PDB:3HB1|D 287 558 1e-172 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179783
Predicted Effect probably damaging
Transcript: ENSMUST00000190337
AA Change: N450Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141112
Gene: ENSMUSG00000025932
AA Change: N450Y

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mutations in this locus affect inner ear morphology and hearing, and result in dysmorphic or absent kidneys. Hypomorphs are deaf and circle. Null homozygotes additionally show agenesis of thymus and parathyroid and thyroid hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Abca12 A G 1: 71,264,767 L2117P probably damaging Het
Ago3 A T 4: 126,368,598 S386R probably benign Het
Agxt T C 1: 93,142,057 probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Anxa1 A G 19: 20,382,923 V108A probably benign Het
Aqp3 A G 4: 41,093,819 F225L probably damaging Het
Atp11b T G 3: 35,834,383 I934R possibly damaging Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Bcr A G 10: 75,125,066 D443G probably benign Het
Cbfa2t3 G T 8: 122,638,859 D211E possibly damaging Het
Ccdc146 A T 5: 21,333,038 L96Q probably damaging Het
Cdh16 A G 8: 104,617,028 I612T probably damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajc2 G A 5: 21,757,773 R521* probably null Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fbxw17 C T 13: 50,432,470 R403C probably benign Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Gatd1 G T 7: 141,408,948 probably benign Het
Gm10330 A T 12: 23,779,960 Y73* probably null Het
Gm21319 T A 12: 87,773,742 K16* probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Hdc C T 2: 126,604,300 E180K probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lamtor3 A T 3: 137,925,148 R27S probably damaging Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Morc1 A G 16: 48,502,336 D332G probably benign Het
Myo15 T C 11: 60,491,667 I1523T probably damaging Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nfix A G 8: 84,772,084 F87L possibly damaging Het
Nup155 C A 15: 8,124,238 T421K probably benign Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr209 A T 16: 59,361,704 N171K probably damaging Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Pds5a A C 5: 65,635,337 V751G probably benign Het
Podnl1 G T 8: 84,126,336 C45F probably damaging Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ptprk T A 10: 28,551,717 I764N probably damaging Het
Rbm33 A T 5: 28,342,411 Q193L probably benign Het
Rnasel C A 1: 153,753,931 H64Q probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Scamp3 A G 3: 89,180,909 probably benign Het
Sema6b C T 17: 56,132,497 probably null Het
Six4 A C 12: 73,103,626 I715R probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spdya A T 17: 71,562,504 Y98F possibly damaging Het
Tert T C 13: 73,646,309 probably null Het
Tex22 G A 12: 113,088,484 C54Y probably damaging Het
Tmem198b C T 10: 128,802,073 R207H probably damaging Het
Trbv13-1 C T 6: 41,116,255 Q42* probably null Het
Trcg1 T C 9: 57,242,279 L378P probably damaging Het
Trpv5 T G 6: 41,659,713 D433A probably damaging Het
Ube3b A G 5: 114,407,641 N654D probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vwa7 A T 17: 35,022,733 Y448F probably damaging Het
Zan A C 5: 137,383,837 D5149E unknown Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zhx1 G A 15: 58,054,142 T236I possibly damaging Het
Other mutations in Eya1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Eya1 APN 1 14270701 splice site probably benign
IGL01110:Eya1 APN 1 14283130 missense probably damaging 1.00
IGL02266:Eya1 APN 1 14184501 missense possibly damaging 0.63
IGL03027:Eya1 APN 1 14170966 missense probably damaging 1.00
IGL03081:Eya1 APN 1 14183191 missense possibly damaging 0.76
IGL03291:Eya1 APN 1 14184348 critical splice donor site probably null
IGL03353:Eya1 APN 1 14179527 missense probably damaging 1.00
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R1428:Eya1 UTSW 1 14304414 splice site probably benign
R1521:Eya1 UTSW 1 14274550 missense probably damaging 0.99
R1571:Eya1 UTSW 1 14208917 missense probably damaging 1.00
R1768:Eya1 UTSW 1 14253075 missense possibly damaging 0.95
R1785:Eya1 UTSW 1 14170974 missense probably benign 0.16
R1840:Eya1 UTSW 1 14229504 nonsense probably null
R2114:Eya1 UTSW 1 14270774 missense probably damaging 1.00
R2131:Eya1 UTSW 1 14170974 missense probably benign 0.16
R2212:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R2416:Eya1 UTSW 1 14270703 critical splice donor site probably null
R2424:Eya1 UTSW 1 14270848 splice site probably benign
R3085:Eya1 UTSW 1 14274090 missense probably benign 0.01
R3158:Eya1 UTSW 1 14304467 start gained probably benign
R3412:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3413:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3693:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3694:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3899:Eya1 UTSW 1 14270747 missense probably benign 0.04
R4454:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4455:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4456:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4458:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4761:Eya1 UTSW 1 14302821 missense probably damaging 1.00
R5011:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5613:Eya1 UTSW 1 14302929 intron probably benign
R5687:Eya1 UTSW 1 14183252 missense probably damaging 0.99
R6052:Eya1 UTSW 1 14283150 missense probably damaging 1.00
R6181:Eya1 UTSW 1 14302872 missense probably damaging 0.99
R6378:Eya1 UTSW 1 14302803 missense possibly damaging 0.93
R6805:Eya1 UTSW 1 14183277 missense probably benign 0.00
R6863:Eya1 UTSW 1 14270975 intron probably null
R7032:Eya1 UTSW 1 14283200 critical splice acceptor site probably null
R7044:Eya1 UTSW 1 14231410 splice site probably null
R7078:Eya1 UTSW 1 14231412 critical splice donor site probably null
R7179:Eya1 UTSW 1 14302852 missense probably damaging 1.00
R7384:Eya1 UTSW 1 14229512 missense probably damaging 1.00
R7462:Eya1 UTSW 1 14231414 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- TATCACTGCAGGCTATCCCAG -3'
(R):5'- GCTTCTCTTGCATCTAAATAGCAC -3'

Sequencing Primer
(F):5'- TATCCCAGGTCACTGCAGG -3'
(R):5'- CATACAACTTTGGAACAGATGGC -3'
Posted On2016-06-06