Incidental Mutation 'R5013:Nfix'
ID390647
Institutional Source Beutler Lab
Gene Symbol Nfix
Ensembl Gene ENSMUSG00000001911
Gene Namenuclear factor I/X
Synonyms
MMRRC Submission 042604-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R5013 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84699876-84800344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84772084 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 87 (F87L)
Ref Sequence ENSEMBL: ENSMUSP00000115691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076715
AA Change: F87L

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911
AA Change: F87L

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099070
AA Change: F87L

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911
AA Change: F87L

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109762
AA Change: F79L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911
AA Change: F79L

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109764
AA Change: F79L

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911
AA Change: F79L

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126806
AA Change: F87L

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911
AA Change: F87L

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 7.1e-31 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 488 1.5e-83 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Abca12 A G 1: 71,264,767 L2117P probably damaging Het
Ago3 A T 4: 126,368,598 S386R probably benign Het
Agxt T C 1: 93,142,057 probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Anxa1 A G 19: 20,382,923 V108A probably benign Het
Aqp3 A G 4: 41,093,819 F225L probably damaging Het
Atp11b T G 3: 35,834,383 I934R possibly damaging Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Bcr A G 10: 75,125,066 D443G probably benign Het
Cbfa2t3 G T 8: 122,638,859 D211E possibly damaging Het
Ccdc146 A T 5: 21,333,038 L96Q probably damaging Het
Cdh16 A G 8: 104,617,028 I612T probably damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajc2 G A 5: 21,757,773 R521* probably null Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fbxw17 C T 13: 50,432,470 R403C probably benign Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Gatd1 G T 7: 141,408,948 probably benign Het
Gm10330 A T 12: 23,779,960 Y73* probably null Het
Gm21319 T A 12: 87,773,742 K16* probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Hdc C T 2: 126,604,300 E180K probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lamtor3 A T 3: 137,925,148 R27S probably damaging Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Morc1 A G 16: 48,502,336 D332G probably benign Het
Myo15 T C 11: 60,491,667 I1523T probably damaging Het
Nagpa A T 16: 5,195,879 M365K probably benign Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nup155 C A 15: 8,124,238 T421K probably benign Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr209 A T 16: 59,361,704 N171K probably damaging Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Pds5a A C 5: 65,635,337 V751G probably benign Het
Podnl1 G T 8: 84,126,336 C45F probably damaging Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ptprk T A 10: 28,551,717 I764N probably damaging Het
Rbm33 A T 5: 28,342,411 Q193L probably benign Het
Rnasel C A 1: 153,753,931 H64Q probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Scamp3 A G 3: 89,180,909 probably benign Het
Sema6b C T 17: 56,132,497 probably null Het
Six4 A C 12: 73,103,626 I715R probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spdya A T 17: 71,562,504 Y98F possibly damaging Het
Tert T C 13: 73,646,309 probably null Het
Tex22 G A 12: 113,088,484 C54Y probably damaging Het
Tmem198b C T 10: 128,802,073 R207H probably damaging Het
Trbv13-1 C T 6: 41,116,255 Q42* probably null Het
Trcg1 T C 9: 57,242,279 L378P probably damaging Het
Trpv5 T G 6: 41,659,713 D433A probably damaging Het
Ube3b A G 5: 114,407,641 N654D probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vwa7 A T 17: 35,022,733 Y448F probably damaging Het
Zan A C 5: 137,383,837 D5149E unknown Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zhx1 G A 15: 58,054,142 T236I possibly damaging Het
Other mutations in Nfix
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nfix APN 8 84726477 missense probably damaging 0.99
IGL01919:Nfix APN 8 84726474 missense probably damaging 1.00
IGL01950:Nfix APN 8 84713786 makesense probably null
IGL02862:Nfix APN 8 84713846 missense probably benign 0.07
R0142:Nfix UTSW 8 84721686 missense probably damaging 1.00
R0309:Nfix UTSW 8 84721774 missense probably damaging 1.00
R0600:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0622:Nfix UTSW 8 84726482 missense probably damaging 0.99
R0628:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0882:Nfix UTSW 8 84727925 missense probably damaging 1.00
R0893:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0975:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1014:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1015:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1162:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1241:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1381:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1513:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1521:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1618:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1865:Nfix UTSW 8 84772275 missense possibly damaging 0.73
R1912:Nfix UTSW 8 84721677 missense probably damaging 1.00
R1974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R2208:Nfix UTSW 8 84716247 frame shift probably null
R2251:Nfix UTSW 8 84716170 missense probably benign 0.03
R2268:Nfix UTSW 8 84716247 frame shift probably null
R2270:Nfix UTSW 8 84716247 frame shift probably null
R2272:Nfix UTSW 8 84727175 missense probably damaging 1.00
R2346:Nfix UTSW 8 84716247 frame shift probably null
R2350:Nfix UTSW 8 84716247 frame shift probably null
R2963:Nfix UTSW 8 84716247 frame shift probably null
R2983:Nfix UTSW 8 84716247 frame shift probably null
R3008:Nfix UTSW 8 84716247 frame shift probably null
R3727:Nfix UTSW 8 84716247 frame shift probably null
R3791:Nfix UTSW 8 84716247 frame shift probably null
R4163:Nfix UTSW 8 84716247 frame shift probably null
R4164:Nfix UTSW 8 84716247 frame shift probably null
R4201:Nfix UTSW 8 84716247 frame shift probably null
R4206:Nfix UTSW 8 84716247 frame shift probably null
R4609:Nfix UTSW 8 84726490 missense probably damaging 1.00
R4801:Nfix UTSW 8 84716247 frame shift probably null
R4802:Nfix UTSW 8 84716247 frame shift probably null
R4914:Nfix UTSW 8 84771829 missense probably benign 0.00
R4915:Nfix UTSW 8 84771829 missense probably benign 0.00
R4916:Nfix UTSW 8 84771829 missense probably benign 0.00
R4918:Nfix UTSW 8 84771829 missense probably benign 0.00
R5290:Nfix UTSW 8 84713777 nonsense probably null
R6418:Nfix UTSW 8 84727149 missense probably benign 0.01
R6554:Nfix UTSW 8 84727650 missense possibly damaging 0.93
R6786:Nfix UTSW 8 84727647 missense probably damaging 1.00
T0970:Nfix UTSW 8 84726483 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATCAGTACTTTCCAAAGGGATCCC -3'
(R):5'- TTCCACCCGTTTATCGAGGC -3'

Sequencing Primer
(F):5'- GGATCCCTTTAAACAAAATCACCATG -3'
(R):5'- TTATCGAGGCGCTGCTGC -3'
Posted On2016-06-06