Incidental Mutation 'R5013:Nagpa'
ID390670
Institutional Source Beutler Lab
Gene Symbol Nagpa
Ensembl Gene ENSMUSG00000023143
Gene NameN-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Synonymsalpha-GlcNAcase, UCE
MMRRC Submission 042604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5013 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5195289-5204012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5195879 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 365 (M365K)
Ref Sequence ENSEMBL: ENSMUSP00000117051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023911] [ENSMUST00000147567]
Predicted Effect probably benign
Transcript: ENSMUST00000023911
AA Change: M508K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023911
Gene: ENSMUSG00000023143
AA Change: M508K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Pfam:DUF2233 131 326 5.1e-42 PFAM
EGF_like 329 359 7.09e1 SMART
EGF 362 391 1.36e1 SMART
transmembrane domain 451 473 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144490
Predicted Effect probably benign
Transcript: ENSMUST00000147567
AA Change: M365K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117051
Gene: ENSMUSG00000023143
AA Change: M365K

DomainStartEndE-ValueType
Pfam:DUF2233 1 183 2.1e-35 PFAM
EGF_like 186 216 7.09e1 SMART
EGF 219 248 1.36e1 SMART
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156450
Meta Mutation Damage Score 0.0444 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hydrolases are transported to lysosomes after binding to mannose 6-phosphate receptors in the trans-Golgi network. This gene encodes the enzyme that catalyzes the second step in the formation of the mannose 6-phosphate recognition marker on lysosomal hydrolases. Commonly known as 'uncovering enzyme' or UCE, this enzyme removes N-acetyl-D-glucosamine (GlcNAc) residues from GlcNAc-alpha-P-mannose moieties and thereby produces the recognition marker. The encoded preproprotein is proteolytically processed by furin to generate the mature enzyme, a homotetramer of two disulfide-linked homodimers. Mutations in this gene are associated with developmental stuttering in human patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele have an increased level of acid hydrolases, however the hydrolases contain GlcNAc-P-Man diesters, exhibit a decreased affinity for the cation-independent mannose 6-phosphate receptor and fail to bind to the cation-dependent mannose 6-phosphate receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik T C 9: 36,637,824 N47D probably benign Het
Abca12 A G 1: 71,264,767 L2117P probably damaging Het
Ago3 A T 4: 126,368,598 S386R probably benign Het
Agxt T C 1: 93,142,057 probably benign Het
Ahctf1 A T 1: 179,784,110 I565N possibly damaging Het
Ank1 C T 8: 23,082,284 T70I probably damaging Het
Anxa1 A G 19: 20,382,923 V108A probably benign Het
Aqp3 A G 4: 41,093,819 F225L probably damaging Het
Atp11b T G 3: 35,834,383 I934R possibly damaging Het
Atp13a5 A T 16: 29,350,748 L42Q probably damaging Het
Bcr A G 10: 75,125,066 D443G probably benign Het
Cbfa2t3 G T 8: 122,638,859 D211E possibly damaging Het
Ccdc146 A T 5: 21,333,038 L96Q probably damaging Het
Cdh16 A G 8: 104,617,028 I612T probably damaging Het
Clcn2 G A 16: 20,707,215 P785S probably damaging Het
Dennd5a A G 7: 109,914,776 I743T possibly damaging Het
Dnah12 T A 14: 26,710,171 D381E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajc2 G A 5: 21,757,773 R521* probably null Het
Dst T C 1: 34,250,647 V5776A probably damaging Het
Epp13 G A 7: 6,266,333 probably benign Het
Ercc4 G A 16: 13,123,581 probably benign Het
Eya1 T A 1: 14,184,358 N417Y probably damaging Het
Fam149b T A 14: 20,363,371 H219Q possibly damaging Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fbxw17 C T 13: 50,432,470 R403C probably benign Het
Fer1l4 T C 2: 156,031,215 Y1315C probably damaging Het
Gatd1 G T 7: 141,408,948 probably benign Het
Gm10330 A T 12: 23,779,960 Y73* probably null Het
Gm21319 T A 12: 87,773,742 K16* probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsn T A 2: 35,298,921 Y440N probably damaging Het
Hdc C T 2: 126,604,300 E180K probably benign Het
Ilk A G 7: 105,742,249 D374G probably damaging Het
Invs G A 4: 48,421,807 R813Q probably damaging Het
Itln1 T A 1: 171,533,390 K45* probably null Het
Ivd A G 2: 118,880,465 Y385C probably damaging Het
Klk1b4 A G 7: 44,211,068 N170S probably benign Het
Klk9 A C 7: 43,795,995 D203A probably damaging Het
Lamtor3 A T 3: 137,925,148 R27S probably damaging Het
Lcn6 T A 2: 25,677,070 probably null Het
Lrriq1 T C 10: 103,189,923 D946G probably damaging Het
Morc1 A G 16: 48,502,336 D332G probably benign Het
Myo15 T C 11: 60,491,667 I1523T probably damaging Het
Nckap5l G T 15: 99,426,576 P682Q probably benign Het
Nfix A G 8: 84,772,084 F87L possibly damaging Het
Nup155 C A 15: 8,124,238 T421K probably benign Het
Olfr1055 A T 2: 86,347,303 F154L probably benign Het
Olfr209 A T 16: 59,361,704 N171K probably damaging Het
Olfr291 T C 7: 84,856,438 V23A probably damaging Het
Olfr367-ps A G 2: 37,270,925 noncoding transcript Het
Pds5a A C 5: 65,635,337 V751G probably benign Het
Podnl1 G T 8: 84,126,336 C45F probably damaging Het
Psme2b C T 11: 48,945,827 E98K probably benign Het
Ptprk T A 10: 28,551,717 I764N probably damaging Het
Rbm33 A T 5: 28,342,411 Q193L probably benign Het
Rnasel C A 1: 153,753,931 H64Q probably damaging Het
Ryr1 G A 7: 29,102,809 probably null Het
Scamp3 A G 3: 89,180,909 probably benign Het
Sema6b C T 17: 56,132,497 probably null Het
Six4 A C 12: 73,103,626 I715R probably benign Het
Slc28a2 T C 2: 122,457,890 M554T possibly damaging Het
Snhg11 T C 2: 158,376,952 probably benign Het
Spdya A T 17: 71,562,504 Y98F possibly damaging Het
Tert T C 13: 73,646,309 probably null Het
Tex22 G A 12: 113,088,484 C54Y probably damaging Het
Tmem198b C T 10: 128,802,073 R207H probably damaging Het
Trbv13-1 C T 6: 41,116,255 Q42* probably null Het
Trcg1 T C 9: 57,242,279 L378P probably damaging Het
Trpv5 T G 6: 41,659,713 D433A probably damaging Het
Ube3b A G 5: 114,407,641 N654D probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vwa7 A T 17: 35,022,733 Y448F probably damaging Het
Zan A C 5: 137,383,837 D5149E unknown Het
Zfp106 A G 2: 120,510,534 W1832R probably damaging Het
Zfp189 G A 4: 49,530,438 G514S probably damaging Het
Zhx1 G A 15: 58,054,142 T236I possibly damaging Het
Other mutations in Nagpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Nagpa APN 16 5195889 missense probably benign 0.02
IGL02719:Nagpa APN 16 5201493 missense possibly damaging 0.78
R1248:Nagpa UTSW 16 5198616 nonsense probably null
R1465:Nagpa UTSW 16 5201528 splice site probably benign
R1746:Nagpa UTSW 16 5203639 missense probably damaging 0.96
R2919:Nagpa UTSW 16 5203787 start gained probably benign
R4382:Nagpa UTSW 16 5203955 missense possibly damaging 0.53
R5011:Nagpa UTSW 16 5195879 missense probably benign
R5207:Nagpa UTSW 16 5199614 critical splice donor site probably null
R5225:Nagpa UTSW 16 5203732 missense probably benign 0.00
R5327:Nagpa UTSW 16 5200013 missense possibly damaging 0.90
R6195:Nagpa UTSW 16 5203749 missense probably damaging 0.98
R6539:Nagpa UTSW 16 5203701 missense possibly damaging 0.79
R6874:Nagpa UTSW 16 5196057 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATTGCTAGGTTGGCATGAGC -3'
(R):5'- TGGGTTCAACATGCCCAGTTTG -3'

Sequencing Primer
(F):5'- CCACAGCATGGGGACAG -3'
(R):5'- AAGACTCTCTTTTCCATCCCAGGAC -3'
Posted On2016-06-06