Incidental Mutation 'R5054:Ptar1'
ID390740
Institutional Source Beutler Lab
Gene Symbol Ptar1
Ensembl Gene ENSMUSG00000074925
Gene Nameprotein prenyltransferase alpha subunit repeat containing 1
Synonyms
MMRRC Submission 042644-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R5054 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23687400-23721129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23694365 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 44 (R44L)
Ref Sequence ENSEMBL: ENSMUSP00000097156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099560]
Predicted Effect probably damaging
Transcript: ENSMUST00000099560
AA Change: R44L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097156
Gene: ENSMUSG00000074925
AA Change: R44L

DomainStartEndE-ValueType
Pfam:PPTA 122 149 3.9e-8 PFAM
Pfam:PPTA 180 207 5e-11 PFAM
Pfam:PPTA 290 315 8e-9 PFAM
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A G 13: 59,689,501 Y257H probably damaging Het
Adam28 C T 14: 68,617,715 C659Y probably damaging Het
Adamtsl2 G A 2: 27,101,720 E627K probably damaging Het
Atad5 T A 11: 80,094,676 S196R probably benign Het
Bcam T A 7: 19,756,860 probably benign Het
Birc6 A G 17: 74,655,325 H3978R probably damaging Het
Btbd7 T C 12: 102,838,212 I190V probably benign Het
Ccdc8 T C 7: 16,995,045 V153A probably damaging Het
Cyp2a5 C G 7: 26,841,104 R68G probably damaging Het
Dock3 T C 9: 106,937,906 Y1254C probably damaging Het
Dync2h1 T C 9: 7,085,007 E2794G possibly damaging Het
Dytn C A 1: 63,661,159 V271L possibly damaging Het
Eif2s2 A C 2: 154,892,670 probably null Het
Fndc7 A G 3: 108,881,347 S193P probably damaging Het
Fzr1 G A 10: 81,371,419 probably benign Het
Gm17472 T C 6: 42,981,004 I69T probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gmppa C A 1: 75,439,371 Y137* probably null Het
Gpr45 A G 1: 43,032,649 I151V probably benign Het
H1f0 G A 15: 79,028,773 A18T probably damaging Het
Hbb-bh1 C T 7: 103,841,856 V114I probably benign Het
Impa2 C A 18: 67,306,727 P98Q probably damaging Het
Kazn T C 4: 142,108,646 N573D unknown Het
Kcna2 A T 3: 107,104,340 D79V probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kif13a A G 13: 46,802,646 Y561H probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra1 T A 6: 130,375,284 Q165L probably damaging Het
Mat2b T A 11: 40,680,042 R318S probably damaging Het
Mgat4d G A 8: 83,368,208 probably null Het
Mtor T A 4: 148,556,855 probably null Het
Nostrin A T 2: 69,175,713 Q247L possibly damaging Het
Obscn T C 11: 59,073,617 E3033G probably damaging Het
Pam C A 1: 97,821,917 D839Y probably damaging Het
Pds5a A G 5: 65,637,814 V693A probably damaging Het
Pigo A T 4: 43,021,337 L535Q probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rad51c T C 11: 87,397,754 H201R probably benign Het
Rims2 A T 15: 39,517,869 probably null Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Rpl22l1 T G 3: 28,806,836 S67A possibly damaging Het
Rps10 A G 17: 27,630,480 S143P probably damaging Het
Rundc1 T C 11: 101,425,141 V13A probably benign Het
Sephs2 C A 7: 127,273,392 M176I probably benign Het
Serpina16 C T 12: 103,674,930 V179I probably benign Het
Serpini2 T A 3: 75,259,477 T158S probably damaging Het
Slc12a3 A G 8: 94,346,351 R701G probably damaging Het
Slc1a6 A G 10: 78,814,602 E558G probably damaging Het
Ssx2ip T C 3: 146,430,917 probably benign Het
Tbr1 A T 2: 61,806,002 I241F possibly damaging Het
Tgfa G C 6: 86,270,082 probably null Het
Tlr12 T A 4: 128,617,270 K396* probably null Het
Tmppe A G 9: 114,405,958 I442V probably benign Het
Tubb3 T C 8: 123,420,868 V180A probably damaging Het
Vmn1r222 A G 13: 23,232,731 V104A probably damaging Het
Vmn2r95 G T 17: 18,451,446 V482L possibly damaging Het
Zfp184 G T 13: 21,959,282 R386L possibly damaging Het
Zfp444 T A 7: 6,189,793 V270E probably damaging Het
Zfp985 A T 4: 147,582,981 Y102F probably damaging Het
Other mutations in Ptar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Ptar1 APN 19 23705801 missense probably damaging 1.00
IGL02608:Ptar1 APN 19 23705712 missense possibly damaging 0.48
R0134:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R0225:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R0395:Ptar1 UTSW 19 23720199 missense probably damaging 1.00
R0551:Ptar1 UTSW 19 23720340 missense probably benign 0.32
R1414:Ptar1 UTSW 19 23720291 missense possibly damaging 0.89
R3114:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R4016:Ptar1 UTSW 19 23687460 start codon destroyed probably null 0.99
R4431:Ptar1 UTSW 19 23694331 missense probably damaging 1.00
R4897:Ptar1 UTSW 19 23703108 missense probably damaging 1.00
R5660:Ptar1 UTSW 19 23694412 missense probably benign 0.32
R5928:Ptar1 UTSW 19 23717913 missense probably benign 0.00
R6333:Ptar1 UTSW 19 23694322 missense possibly damaging 0.65
R6610:Ptar1 UTSW 19 23717844 missense probably benign 0.01
R6834:Ptar1 UTSW 19 23717924 missense probably benign
R6915:Ptar1 UTSW 19 23703137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAGTGAGTAAATCTGGGG -3'
(R):5'- AGAGTCCAGGAATGCCAACC -3'

Sequencing Primer
(F):5'- AGACAGGGTCTCACTGTGTAATCC -3'
(R):5'- CCCAAGCCAGGTCTCCTC -3'
Posted On2016-06-06