Incidental Mutation 'R5055:Adam19'
ID390794
Institutional Source Beutler Lab
Gene Symbol Adam19
Ensembl Gene ENSMUSG00000011256
Gene Namea disintegrin and metallopeptidase domain 19 (meltrin beta)
SynonymsMltnb
MMRRC Submission 042645-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5055 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46055992-46147343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46123169 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 329 (V329I)
Ref Sequence ENSEMBL: ENSMUSP00000011400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400]
Predicted Effect probably damaging
Transcript: ENSMUST00000011400
AA Change: V329I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: V329I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151565
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 C A 5: 81,646,551 A541E possibly damaging Het
Agbl1 A T 7: 76,413,577 I263F probably damaging Het
Ash1l T C 3: 89,023,212 probably null Het
BC051142 G A 17: 34,448,796 C154Y possibly damaging Het
Bccip A G 7: 133,714,923 T91A probably benign Het
Bnc1 A T 7: 81,974,415 F355I probably damaging Het
Bpifa2 A T 2: 154,013,710 D185V probably damaging Het
Capn8 T A 1: 182,571,961 V89D probably damaging Het
Cfap46 A T 7: 139,661,190 M421K probably damaging Het
Chd2 A T 7: 73,480,508 L800M probably damaging Het
Chd4 A G 6: 125,100,986 D137G possibly damaging Het
Crtap A G 9: 114,390,140 Y154H probably benign Het
Ctdp1 T A 18: 80,456,088 Q213L probably damaging Het
Cts6 T C 13: 61,196,350 Y296C probably damaging Het
Daxx G T 17: 33,912,160 V354F probably benign Het
Dnah2 A G 11: 69,520,773 I341T possibly damaging Het
Epha2 A G 4: 141,309,069 D272G probably benign Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fbxl7 C A 15: 26,552,936 G82W probably damaging Het
Fcamr G A 1: 130,811,437 C158Y probably damaging Het
Fyb A C 15: 6,585,149 probably benign Het
Gars G A 6: 55,068,092 R454H probably damaging Het
Ghsr T C 3: 27,372,272 V159A probably benign Het
Glp1r A T 17: 30,918,887 Q97H probably benign Het
Gm27047 T C 6: 130,629,946 noncoding transcript Het
Igkv3-3 A C 6: 70,687,239 I22L probably benign Het
Inpp5b G T 4: 124,743,031 probably null Het
Ipo9 C A 1: 135,402,359 E448* probably null Het
Itgb2l A T 16: 96,427,803 I400N probably damaging Het
Kat6b T A 14: 21,516,994 H40Q probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnq2 G T 2: 181,086,761 probably benign Het
Klf7 T C 1: 64,079,280 T53A probably benign Het
Kmt2a A G 9: 44,818,352 probably benign Het
Lrp10 C T 14: 54,468,345 R331C probably benign Het
Map4k5 A T 12: 69,831,558 D289E probably benign Het
Mfsd4b2 A T 10: 39,923,777 M43K possibly damaging Het
Msr1 T G 8: 39,623,956 R138S possibly damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Myh9 G A 15: 77,764,523 A1711V probably benign Het
Myo18b A G 5: 112,875,217 probably benign Het
Nampt A T 12: 32,833,121 N102Y possibly damaging Het
Nell2 T C 15: 95,473,579 I92V probably benign Het
Nes A G 3: 87,977,214 N883D probably benign Het
Neurl3 T A 1: 36,273,382 probably benign Het
Ocln T A 13: 100,539,422 T188S probably benign Het
Olfr1023 T C 2: 85,887,241 F147S probably benign Het
Olfr704 T A 7: 106,865,730 M250K probably damaging Het
Parp14 T A 16: 35,844,363 Q1305L probably benign Het
Pde3a C T 6: 141,487,956 Q855* probably null Het
Pde4b T C 4: 102,195,114 probably benign Het
Pdk2 T C 11: 95,039,416 M65V probably benign Het
Phf21a T C 2: 92,351,856 S377P probably damaging Het
Plcb2 T A 2: 118,718,222 T408S probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ppp6r2 A G 15: 89,282,949 D789G probably benign Het
Prdm16 T C 4: 154,335,262 M897V possibly damaging Het
Prss57 A G 10: 79,784,344 probably null Het
Psd G T 19: 46,322,468 L381I probably benign Het
Ptprq A T 10: 107,534,679 D2050E probably benign Het
Rfc1 G T 5: 65,266,162 N1034K probably damaging Het
Ryr3 C T 2: 112,831,159 G1829S probably benign Het
Scaper T C 9: 55,859,719 probably null Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Slc28a1 A G 7: 81,169,048 N583S possibly damaging Het
Slc35e3 C T 10: 117,744,979 G140D probably damaging Het
Slc6a9 G A 4: 117,868,150 probably null Het
Sptlc1 A G 13: 53,342,182 S376P probably benign Het
Sspo G A 6: 48,464,795 C1913Y probably damaging Het
Taar7b A T 10: 24,000,947 I337F possibly damaging Het
Tdpoz2 T A 3: 93,651,928 I246F probably damaging Het
Trpa1 C T 1: 14,875,959 V983M probably damaging Het
Trpm5 A T 7: 143,072,784 M1112K probably benign Het
Uso1 A T 5: 92,192,735 K670I probably benign Het
Washc4 A G 10: 83,556,907 D257G probably damaging Het
Wdr41 T A 13: 95,015,217 probably null Het
Zbtb17 A G 4: 141,466,549 Q668R possibly damaging Het
Other mutations in Adam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Adam19 APN 11 46112783 missense probably damaging 1.00
IGL01727:Adam19 APN 11 46121553 missense probably benign
IGL01758:Adam19 APN 11 46112924 missense probably benign 0.01
IGL02160:Adam19 APN 11 46139695 missense probably damaging 0.99
IGL02421:Adam19 APN 11 46137553 missense probably damaging 0.96
IGL02572:Adam19 APN 11 46131721 nonsense probably null
IGL02995:Adam19 APN 11 46136349 missense probably benign 0.00
IGL03171:Adam19 APN 11 46138854 missense probably damaging 0.98
IGL03237:Adam19 APN 11 46137556 missense probably benign
R0003:Adam19 UTSW 11 46128789 missense probably damaging 1.00
R0026:Adam19 UTSW 11 46136259 missense probably damaging 1.00
R0158:Adam19 UTSW 11 46143034 missense probably damaging 1.00
R0304:Adam19 UTSW 11 46127392 missense possibly damaging 0.91
R0488:Adam19 UTSW 11 46138930 missense probably damaging 0.98
R0501:Adam19 UTSW 11 46123130 missense probably damaging 1.00
R0591:Adam19 UTSW 11 46121411 splice site probably benign
R0734:Adam19 UTSW 11 46127403 missense probably damaging 0.99
R0747:Adam19 UTSW 11 46118495 splice site probably null
R0771:Adam19 UTSW 11 46121453 missense possibly damaging 0.92
R1052:Adam19 UTSW 11 46127265 missense probably damaging 0.99
R1573:Adam19 UTSW 11 46113618 splice site probably benign
R1735:Adam19 UTSW 11 46138917 missense probably benign 0.26
R1830:Adam19 UTSW 11 46127278 missense probably damaging 0.98
R1911:Adam19 UTSW 11 46121454 missense probably damaging 1.00
R2092:Adam19 UTSW 11 46060904 intron probably null
R3749:Adam19 UTSW 11 46137610 missense probably benign 0.00
R3893:Adam19 UTSW 11 46128838 missense probably damaging 1.00
R3916:Adam19 UTSW 11 46060935 missense probably benign 0.25
R3917:Adam19 UTSW 11 46060935 missense probably benign 0.25
R4506:Adam19 UTSW 11 46118444 missense possibly damaging 0.67
R4767:Adam19 UTSW 11 46138977 critical splice donor site probably null
R5313:Adam19 UTSW 11 46131776 missense probably damaging 1.00
R5329:Adam19 UTSW 11 46125026 missense probably damaging 0.99
R5567:Adam19 UTSW 11 46136250 missense probably damaging 1.00
R5602:Adam19 UTSW 11 46136315 missense probably benign
R6198:Adam19 UTSW 11 46121502 missense probably damaging 1.00
R6875:Adam19 UTSW 11 46112875 missense probably benign
R7011:Adam19 UTSW 11 46143018 missense probably benign 0.00
R7163:Adam19 UTSW 11 46131717 missense probably benign
R7213:Adam19 UTSW 11 46121471 missense probably benign 0.20
R7267:Adam19 UTSW 11 46121576 nonsense probably null
X0067:Adam19 UTSW 11 46056115 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- AACAGGCTTGTCCTCTTGGG -3'
(R):5'- GAATGAAATTTTACCCCTGGCTAC -3'

Sequencing Primer
(F):5'- CCTCTTGGGACTAATCTGGGAAG -3'
(R):5'- TGGCTACTATCCTTTGAACCTAAG -3'
Posted On2016-06-06