Incidental Mutation 'R5056:F5'
ID390822
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Namecoagulation factor V
SynonymsCf-5, Cf5
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5056 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164151838-164220277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 164192032 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 692 (Y692F)
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086040
AA Change: Y692F

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: Y692F

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cmtr1 A G 17: 29,690,328 T404A possibly damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164179524 missense probably benign 0.15
IGL00843:F5 APN 1 164211791 missense probably benign 0.00
IGL00904:F5 APN 1 164194009 missense probably benign
IGL00913:F5 APN 1 164204896 missense probably damaging 1.00
IGL01099:F5 APN 1 164194334 missense probably damaging 0.99
IGL01134:F5 APN 1 164191979 missense possibly damaging 0.87
IGL01313:F5 APN 1 164193612 missense probably benign 0.01
IGL01635:F5 APN 1 164207858 missense probably benign 0.00
IGL01697:F5 APN 1 164194052 missense probably benign 0.04
IGL01768:F5 APN 1 164176345 missense probably benign 0.22
IGL01795:F5 APN 1 164194390 missense probably benign 0.00
IGL01835:F5 APN 1 164194368 missense probably benign 0.12
IGL01843:F5 APN 1 164211826 missense probably benign 0.05
IGL01989:F5 APN 1 164176307 missense probably benign 0.39
IGL02036:F5 APN 1 164183002 splice site probably benign
IGL02065:F5 APN 1 164190126 missense probably damaging 1.00
IGL02077:F5 APN 1 164198866 missense probably damaging 1.00
IGL02139:F5 APN 1 164192674 missense possibly damaging 0.89
IGL02210:F5 APN 1 164190141 missense probably benign 0.00
IGL02415:F5 APN 1 164191929 missense probably damaging 1.00
IGL02440:F5 APN 1 164207066 missense possibly damaging 0.79
IGL02471:F5 APN 1 164174291 missense probably damaging 1.00
IGL02535:F5 APN 1 164198733 missense probably damaging 0.98
IGL02537:F5 APN 1 164193117 missense probably benign 0.26
IGL02628:F5 APN 1 164194075 missense probably damaging 0.99
IGL02638:F5 APN 1 164184608 critical splice donor site probably null
IGL02824:F5 APN 1 164194347 missense probably benign 0.00
IGL02977:F5 APN 1 164194021 missense probably damaging 1.00
IGL03028:F5 APN 1 164193000 nonsense probably null
IGL03064:F5 APN 1 164195594 missense probably benign 0.04
IGL03127:F5 APN 1 164193538 missense probably benign 0.45
IGL03131:F5 APN 1 164161819 missense possibly damaging 0.62
IGL03348:F5 APN 1 164194152 missense possibly damaging 0.49
IGL03387:F5 APN 1 164193232 missense probably damaging 1.00
James_dean UTSW 1 164204820 missense probably benign 0.43
R0002:F5 UTSW 1 164201631 missense probably damaging 1.00
R0095:F5 UTSW 1 164191968 nonsense probably null
R0116:F5 UTSW 1 164184914 missense probably benign 0.01
R0359:F5 UTSW 1 164179449 missense probably damaging 1.00
R0426:F5 UTSW 1 164182840 missense probably damaging 0.99
R0452:F5 UTSW 1 164185107 missense probably damaging 0.99
R0457:F5 UTSW 1 164194200 missense probably benign 0.00
R0520:F5 UTSW 1 164209587 missense probably benign 0.15
R0522:F5 UTSW 1 164211763 missense probably damaging 1.00
R0554:F5 UTSW 1 164179449 missense probably damaging 1.00
R0575:F5 UTSW 1 164176244 missense probably damaging 1.00
R0734:F5 UTSW 1 164198917 missense probably damaging 1.00
R0739:F5 UTSW 1 164198917 missense probably damaging 1.00
R1062:F5 UTSW 1 164198917 missense probably damaging 1.00
R1063:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1150:F5 UTSW 1 164198917 missense probably damaging 1.00
R1151:F5 UTSW 1 164198917 missense probably damaging 1.00
R1152:F5 UTSW 1 164198917 missense probably damaging 1.00
R1221:F5 UTSW 1 164161799 missense probably damaging 1.00
R1284:F5 UTSW 1 164198917 missense probably damaging 1.00
R1286:F5 UTSW 1 164198917 missense probably damaging 1.00
R1358:F5 UTSW 1 164198917 missense probably damaging 1.00
R1360:F5 UTSW 1 164198917 missense probably damaging 1.00
R1362:F5 UTSW 1 164198917 missense probably damaging 1.00
R1383:F5 UTSW 1 164198917 missense probably damaging 1.00
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1545:F5 UTSW 1 164208960 nonsense probably null
R1561:F5 UTSW 1 164186903 nonsense probably null
R1623:F5 UTSW 1 164195622 missense probably damaging 1.00
R1662:F5 UTSW 1 164207888 missense probably damaging 1.00
R1673:F5 UTSW 1 164179520 missense probably damaging 1.00
R1689:F5 UTSW 1 164198917 missense probably damaging 1.00
R1705:F5 UTSW 1 164217490 missense possibly damaging 0.92
R1732:F5 UTSW 1 164174150 missense probably damaging 1.00
R1763:F5 UTSW 1 164192535 missense probably benign 0.04
R1774:F5 UTSW 1 164192535 missense probably benign 0.04
R1799:F5 UTSW 1 164193531 missense possibly damaging 0.58
R1800:F5 UTSW 1 164182834 missense probably damaging 1.00
R1842:F5 UTSW 1 164184560 missense probably damaging 0.99
R1915:F5 UTSW 1 164182917 missense probably damaging 0.97
R1926:F5 UTSW 1 164179508 missense probably damaging 1.00
R2025:F5 UTSW 1 164209475 missense probably benign 0.05
R2198:F5 UTSW 1 164207034 missense probably damaging 1.00
R2258:F5 UTSW 1 164192181 missense probably damaging 1.00
R2264:F5 UTSW 1 164194402 missense probably benign 0.32
R2281:F5 UTSW 1 164195720 missense possibly damaging 0.80
R2407:F5 UTSW 1 164211872 missense probably damaging 1.00
R2445:F5 UTSW 1 164190226 missense probably damaging 1.00
R2860:F5 UTSW 1 164184964 missense probably damaging 1.00
R2861:F5 UTSW 1 164184964 missense probably damaging 1.00
R2862:F5 UTSW 1 164184964 missense probably damaging 1.00
R2899:F5 UTSW 1 164186900 missense possibly damaging 0.88
R2910:F5 UTSW 1 164204820 missense probably benign 0.43
R2912:F5 UTSW 1 164193919 missense probably damaging 0.98
R2996:F5 UTSW 1 164182917 missense probably damaging 0.97
R3745:F5 UTSW 1 164186779 missense possibly damaging 0.79
R3901:F5 UTSW 1 164176229 missense probably benign 0.08
R3902:F5 UTSW 1 164176229 missense probably benign 0.08
R4365:F5 UTSW 1 164184950 missense probably damaging 0.98
R4448:F5 UTSW 1 164198899 missense possibly damaging 0.52
R4490:F5 UTSW 1 164217395 missense probably benign 0.40
R4514:F5 UTSW 1 164151997 unclassified probably benign
R4598:F5 UTSW 1 164204797 missense probably benign 0.05
R4608:F5 UTSW 1 164209029 missense probably benign 0.12
R4661:F5 UTSW 1 164184920 missense probably damaging 1.00
R4667:F5 UTSW 1 164174186 missense probably benign 0.00
R4689:F5 UTSW 1 164151973 unclassified probably benign
R4716:F5 UTSW 1 164193919 missense probably damaging 0.98
R4732:F5 UTSW 1 164181657 missense probably damaging 1.00
R4733:F5 UTSW 1 164181657 missense probably damaging 1.00
R4854:F5 UTSW 1 164192146 missense probably damaging 1.00
R4908:F5 UTSW 1 164211820 missense probably damaging 1.00
R4971:F5 UTSW 1 164194186 missense probably benign
R5001:F5 UTSW 1 164195570 missense probably benign 0.00
R5042:F5 UTSW 1 164219451 missense probably damaging 1.00
R5061:F5 UTSW 1 164194180 missense probably benign 0.00
R5143:F5 UTSW 1 164211828 missense probably damaging 0.98
R5622:F5 UTSW 1 164192565 missense probably benign 0.09
R5626:F5 UTSW 1 164209035 missense probably damaging 0.98
R5658:F5 UTSW 1 164192338 missense probably damaging 0.96
R5702:F5 UTSW 1 164194547 nonsense probably null
R5795:F5 UTSW 1 164152009 missense probably benign 0.09
R5884:F5 UTSW 1 164195646 missense probably benign 0.01
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6151:F5 UTSW 1 164181635 missense probably damaging 1.00
R6151:F5 UTSW 1 164190187 missense probably damaging 1.00
R6345:F5 UTSW 1 164191951 missense probably benign 0.13
R6391:F5 UTSW 1 164193493 missense probably damaging 0.99
R6542:F5 UTSW 1 164194468 missense probably benign 0.32
R6620:F5 UTSW 1 164186806 missense probably damaging 1.00
R6750:F5 UTSW 1 164193507 missense possibly damaging 0.58
R6754:F5 UTSW 1 164193763 missense probably damaging 1.00
R6774:F5 UTSW 1 164186878 missense probably damaging 1.00
R6802:F5 UTSW 1 164179356 missense probably damaging 0.98
R6810:F5 UTSW 1 164186902 missense probably damaging 1.00
R6983:F5 UTSW 1 164194129 missense probably damaging 1.00
R7000:F5 UTSW 1 164179506 missense probably damaging 1.00
R7151:F5 UTSW 1 164201661 missense probably damaging 1.00
X0024:F5 UTSW 1 164192988 missense probably damaging 1.00
Z1088:F5 UTSW 1 164154385 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGGCTACCTCTGGTTAAAATTCAC -3'
(R):5'- GAGCAGTGAGATTGAACTCATTTTC -3'

Sequencing Primer
(F):5'- AAAATTTTTCTCCAACAGATCCTCC -3'
(R):5'- GAGATTGAACTCATTTTCCTCTGG -3'
Posted On2016-06-06