Incidental Mutation 'R5056:Cmtr1'
ID390870
Institutional Source Beutler Lab
Gene Symbol Cmtr1
Ensembl Gene ENSMUSG00000024019
Gene Namecap methyltransferase 1
SynonymsFtsjd2, 1300018I05Rik
MMRRC Submission 042646-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.982) question?
Stock #R5056 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location29660595-29705979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29690328 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 404 (T404A)
Ref Sequence ENSEMBL: ENSMUSP00000024816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024816] [ENSMUST00000130871] [ENSMUST00000137079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024816
AA Change: T404A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024816
Gene: ENSMUSG00000024019
AA Change: T404A

DomainStartEndE-ValueType
G_patch 84 130 1.93e-10 SMART
Pfam:FtsJ 231 448 9.5e-42 PFAM
SCOP:d1ckma2 625 718 4e-3 SMART
WW 752 785 2.05e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130052
Predicted Effect probably benign
Transcript: ENSMUST00000130871
SMART Domains Protein: ENSMUSP00000117838
Gene: ENSMUSG00000098374

DomainStartEndE-ValueType
FHA 37 92 5.55e-8 SMART
low complexity region 116 130 N/A INTRINSIC
low complexity region 299 317 N/A INTRINSIC
RING 406 443 3.64e-7 SMART
G_patch 524 570 1.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137079
SMART Domains Protein: ENSMUSP00000115603
Gene: ENSMUSG00000024018

DomainStartEndE-ValueType
Pfam:CCDC-167 9 53 1.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172610
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,682 K229* probably null Het
9930021J03Rik A T 19: 29,717,359 I1578K probably benign Het
Adora2a T A 10: 75,326,158 S44T probably damaging Het
Agap3 T C 5: 24,477,862 V459A probably damaging Het
Apc2 T C 10: 80,301,314 V31A probably benign Het
Asic2 T A 11: 80,971,603 K189N possibly damaging Het
Bbs10 C T 10: 111,300,540 P505S probably benign Het
C87414 T C 5: 93,638,925 probably benign Het
Cdh20 G T 1: 104,953,997 V396L probably benign Het
Cenpb C T 2: 131,178,171 probably benign Het
Chil6 T A 3: 106,394,343 Y147F probably damaging Het
Cluh C T 11: 74,661,946 R606C probably damaging Het
Cnot1 T C 8: 95,741,008 N1499S probably damaging Het
Dmkn T C 7: 30,764,104 S61P probably damaging Het
Dmxl1 T C 18: 49,870,923 C872R probably benign Het
Dnah3 A G 7: 120,020,946 Y1587H probably damaging Het
Dsc2 A T 18: 20,050,142 V73D probably damaging Het
F5 A T 1: 164,192,032 Y692F possibly damaging Het
Fam184a A T 10: 53,674,574 L80I probably damaging Het
Fam46b C T 4: 133,480,438 R47W possibly damaging Het
Foxj2 A G 6: 122,833,874 H271R probably benign Het
Grm7 A G 6: 111,080,443 T335A probably damaging Het
Hspa9 A G 18: 34,938,681 L622P probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnd3 T A 3: 105,666,928 probably benign Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrch4 C G 5: 137,636,851 N237K probably damaging Het
Lss T G 10: 76,552,926 probably null Het
Map6 T C 7: 99,336,652 F588L probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Med13 A T 11: 86,328,565 S352T probably benign Het
Mettl16 T A 11: 74,816,940 V320E probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nup188 T A 2: 30,304,131 D149E probably damaging Het
Ogfrl1 A G 1: 23,379,049 S83P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,136 D70E probably damaging Het
Olfr1083-ps T A 2: 86,607,020 I184F unknown Het
Olfr1154 T C 2: 87,903,571 Y35C probably damaging Het
Olfr685 T A 7: 105,180,572 H262L probably damaging Het
Pafah1b3 C T 7: 25,295,339 R98Q probably damaging Het
Pde6b A T 5: 108,423,491 K437* probably null Het
Ppp1r12b A T 1: 134,834,392 probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prdm9 T C 17: 15,562,417 Q104R possibly damaging Het
Rgs22 A T 15: 36,050,245 probably null Het
Rnf14 C T 18: 38,308,388 P277L probably damaging Het
Robo4 T C 9: 37,404,806 S258P probably benign Het
Sfrp1 T A 8: 23,417,404 F207I probably damaging Het
Sgms1 A G 19: 32,159,687 S160P probably damaging Het
Sil1 T C 18: 35,269,702 K263R probably benign Het
St14 A G 9: 31,097,551 probably null Het
Syne2 A G 12: 75,909,131 probably benign Het
Tbc1d9 T C 8: 83,269,206 S1013P probably benign Het
Tmem67 T C 4: 12,070,471 S352G probably benign Het
Trib2 C A 12: 15,793,794 K282N possibly damaging Het
Trnau1ap T C 4: 132,327,171 probably benign Het
Trpm4 T C 7: 45,308,630 D952G probably damaging Het
Unc93b1 A G 19: 3,942,762 N305D possibly damaging Het
Usp32 A G 11: 85,026,795 V802A probably benign Het
Vmn2r48 T A 7: 9,942,324 H410L probably damaging Het
Wfs1 T C 5: 36,975,587 N116S probably benign Het
Wif1 A T 10: 121,099,779 H333L probably benign Het
Zfp109 T C 7: 24,228,737 T416A possibly damaging Het
Zfp808 T A 13: 62,172,630 C558S probably damaging Het
Zpbp T C 11: 11,459,734 D116G possibly damaging Het
Other mutations in Cmtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cmtr1 APN 17 29674262 missense probably damaging 0.99
IGL00980:Cmtr1 APN 17 29691284 missense probably benign 0.00
IGL00987:Cmtr1 APN 17 29697169 missense probably benign 0.01
IGL01413:Cmtr1 APN 17 29697982 missense probably benign 0.00
IGL01481:Cmtr1 APN 17 29698657 missense probably benign 0.02
IGL02281:Cmtr1 APN 17 29691281 missense probably benign 0.00
IGL03079:Cmtr1 APN 17 29663293 missense possibly damaging 0.71
IGL03376:Cmtr1 APN 17 29691411 missense probably benign 0.00
PIT4403001:Cmtr1 UTSW 17 29698073 critical splice donor site probably null
R0256:Cmtr1 UTSW 17 29697124 missense probably damaging 1.00
R0505:Cmtr1 UTSW 17 29676285 missense probably benign 0.17
R1477:Cmtr1 UTSW 17 29697157 missense possibly damaging 0.63
R1623:Cmtr1 UTSW 17 29687047 unclassified probably null
R1852:Cmtr1 UTSW 17 29702255 missense probably benign 0.32
R1867:Cmtr1 UTSW 17 29674174 missense probably benign 0.36
R1918:Cmtr1 UTSW 17 29679009 missense possibly damaging 0.63
R2070:Cmtr1 UTSW 17 29694783 critical splice acceptor site probably null
R2071:Cmtr1 UTSW 17 29694783 critical splice acceptor site probably null
R2161:Cmtr1 UTSW 17 29702173 missense probably benign 0.03
R2518:Cmtr1 UTSW 17 29681980 nonsense probably null
R2763:Cmtr1 UTSW 17 29680628 missense possibly damaging 0.89
R4077:Cmtr1 UTSW 17 29685975 missense probably damaging 1.00
R4271:Cmtr1 UTSW 17 29697982 missense probably benign 0.00
R4363:Cmtr1 UTSW 17 29674232 missense probably damaging 1.00
R4723:Cmtr1 UTSW 17 29687157 splice site probably null
R4736:Cmtr1 UTSW 17 29700242 missense possibly damaging 0.94
R5492:Cmtr1 UTSW 17 29690342 missense probably damaging 1.00
R5704:Cmtr1 UTSW 17 29663243 missense possibly damaging 0.95
R5990:Cmtr1 UTSW 17 29702161 missense probably benign
R6050:Cmtr1 UTSW 17 29682134 missense probably damaging 1.00
R6117:Cmtr1 UTSW 17 29682165 missense probably benign 0.43
R6238:Cmtr1 UTSW 17 29682148 missense probably damaging 1.00
R7199:Cmtr1 UTSW 17 29676200 missense probably benign
R7229:Cmtr1 UTSW 17 29695424 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACGTTGTATCAATCAGGTGGC -3'
(R):5'- CAGACAAAAGCACAGGGTTTGC -3'

Sequencing Primer
(F):5'- GTATCAATCAGGTGGCTGACC -3'
(R):5'- CACAGGGTTTGCGGCTG -3'
Posted On2016-06-06