Incidental Mutation 'R5057:Por'
ID390916
Institutional Source Beutler Lab
Gene Symbol Por
Ensembl Gene ENSMUSG00000005514
Gene NameP450 (cytochrome) oxidoreductase
SynonymsNADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
MMRRC Submission 042647-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5057 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135670033-135735326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135730902 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000121531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005651] [ENSMUST00000043378] [ENSMUST00000122113] [ENSMUST00000127096] [ENSMUST00000153500] [ENSMUST00000153515]
Predicted Effect probably damaging
Transcript: ENSMUST00000005651
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005651
Gene: ENSMUSG00000005514
AA Change: D189G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 1.6e-40 PFAM
Pfam:FAD_binding_1 274 493 1.3e-84 PFAM
Pfam:NAD_binding_1 530 642 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043378
SMART Domains Protein: ENSMUSP00000045252
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 13 336 4.2e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122113
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112924
Gene: ENSMUSG00000005514
AA Change: D189G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 2.6e-40 PFAM
Pfam:FAD_binding_1 274 493 5.1e-87 PFAM
Pfam:NAD_binding_1 530 605 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127096
SMART Domains Protein: ENSMUSP00000119138
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Flavodoxin_1 127 168 5.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149684
Predicted Effect probably damaging
Transcript: ENSMUST00000153500
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121531
Gene: ENSMUSG00000005514
AA Change: D189G

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 5.9e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153515
AA Change: D189G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121022
Gene: ENSMUSG00000005514
AA Change: D189G

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 3.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199952
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects of the neural tube, eye, heart, and limbs, retarded growth, and prenatal lethality. Liver-specific knockouts exhibit increased liver weight, hepatic lipidosis, and impaired drug metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,225,421 F207I probably benign Het
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Acad12 T A 5: 121,610,089 T89S probably benign Het
Adgb A G 10: 10,357,978 C1252R probably benign Het
Ankef1 A G 2: 136,550,360 probably null Het
Ankfy1 T C 11: 72,759,919 L976P probably damaging Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
Ankrd61 T A 5: 143,894,795 T64S probably benign Het
Anxa6 T G 11: 55,001,236 E298A possibly damaging Het
Apc2 A G 10: 80,309,069 S605G probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Bptf A T 11: 107,082,528 F693L probably damaging Het
Cacng4 A G 11: 107,794,371 Y32H probably damaging Het
Ccdc50 T A 16: 27,438,342 D252E probably benign Het
Ccdc92b C A 11: 74,638,150 T160K probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh22 C A 2: 165,116,143 V635F probably damaging Het
Cenpe G T 3: 135,220,313 A243S probably benign Het
Cep295 A T 9: 15,322,683 H2272Q probably benign Het
Cgnl1 A T 9: 71,724,794 V425D probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Cntnap5a C T 1: 115,685,213 T26I probably benign Het
Col6a3 T C 1: 90,816,130 K165R possibly damaging Het
Copb1 A T 7: 114,226,762 N662K probably benign Het
Crybg1 T A 10: 43,989,108 R1458* probably null Het
Cspp1 T A 1: 10,074,961 probably benign Het
Dhtkd1 A G 2: 5,919,513 C430R probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Ephb3 A G 16: 21,220,447 D351G probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fam161a T A 11: 23,020,397 C192S probably damaging Het
Fbn1 A G 2: 125,466,695 V149A probably benign Het
Fbxw16 A G 9: 109,441,164 S170P probably damaging Het
Fndc1 T A 17: 7,771,970 R965* probably null Het
Frem2 T C 3: 53,535,196 D2640G probably benign Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm44501 A G 17: 40,578,672 T26A probably benign Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5045 A T 15: 59,211,155 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpsm1 G A 2: 26,325,357 R277Q probably damaging Het
Inmt T A 6: 55,174,898 H29L probably benign Het
Insrr T A 3: 87,815,265 C1265S probably benign Het
Kctd12 A G 14: 102,981,609 F278L possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lag3 T A 6: 124,905,355 I393F possibly damaging Het
Lama2 C T 10: 27,164,986 C1447Y probably damaging Het
Lama3 G A 18: 12,531,948 G2275S probably null Het
Lrrc17 A T 5: 21,575,309 H427L probably benign Het
Med13l T A 5: 118,718,493 S164T probably damaging Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Myo5c A T 9: 75,300,873 T1630S probably damaging Het
Nbeal2 A T 9: 110,631,005 N1848K probably damaging Het
Ncor2 A T 5: 125,048,066 V307E possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Nipal3 T A 4: 135,466,856 I289F probably damaging Het
Nrg4 A G 9: 55,282,596 probably benign Het
Nrxn3 A T 12: 89,255,034 I528F probably damaging Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr748 A C 14: 50,711,212 N294T probably damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcnx2 T C 8: 125,855,191 I935M possibly damaging Het
Pik3c2a G T 7: 116,376,283 T683K possibly damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkd1l2 G A 8: 117,055,008 T766I probably benign Het
Polr3c C A 3: 96,712,057 L508F probably damaging Het
Prim2 A T 1: 33,630,360 L178* probably null Het
Prima1 C A 12: 103,202,605 probably null Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rbm12 A T 2: 156,096,886 C489S probably benign Het
Rpl10a A T 17: 28,330,633 H140L probably benign Het
Rtbdn T C 8: 84,955,009 F143S probably damaging Het
Scamp3 T A 3: 89,182,293 probably benign Het
Setd5 A G 6: 113,137,961 S848G probably damaging Het
Sez6 T C 11: 77,973,153 V487A probably damaging Het
Shc2 G A 10: 79,623,872 P413S probably benign Het
Sipa1l3 T C 7: 29,371,193 N966S probably damaging Het
Slc39a8 A G 3: 135,849,029 E78G probably benign Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Spire2 G A 8: 123,358,201 R260H probably damaging Het
Stk39 T A 2: 68,220,948 I518F probably damaging Het
Tardbp T A 4: 148,619,356 probably null Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Tll2 A G 19: 41,117,266 V358A probably benign Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tnfsf9 A G 17: 57,105,444 T5A probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim5 A G 7: 104,265,423 Y480H probably damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttn T A 2: 76,747,035 K22759* probably null Het
Ttn C A 2: 76,918,644 L4020F probably benign Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Ube3b T C 5: 114,406,257 F572L probably benign Het
Ubr5 A G 15: 38,004,109 V1332A probably damaging Het
Ubtd2 C A 11: 32,516,320 R180S probably damaging Het
Ubtf A G 11: 102,307,087 S673P probably damaging Het
Ubtfl1 A T 9: 18,409,191 D5V possibly damaging Het
Usp17la G A 7: 104,861,123 V312I possibly damaging Het
Usp17ld G T 7: 103,250,448 H426N probably benign Het
Usp34 A G 11: 23,458,086 probably benign Het
Vmn1r199 A T 13: 22,383,405 T290S possibly damaging Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vmn2r6 T A 3: 64,537,786 K839N probably damaging Het
Vmn2r65 A G 7: 84,940,611 I699T probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Wdr60 A T 12: 116,213,413 N856K probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Por
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Por APN 5 135734186 nonsense probably null
IGL02126:Por APN 5 135715975 missense probably benign 0.00
R0201:Por UTSW 5 135731178 missense possibly damaging 0.94
R0355:Por UTSW 5 135732584 missense probably benign 0.38
R1755:Por UTSW 5 135729485 nonsense probably null
R1886:Por UTSW 5 135734274 missense probably damaging 1.00
R4057:Por UTSW 5 135731574 missense probably damaging 1.00
R4282:Por UTSW 5 135715961 missense possibly damaging 0.48
R4761:Por UTSW 5 135725930 intron probably benign
R5064:Por UTSW 5 135733795 missense probably benign 0.23
R5159:Por UTSW 5 135730917 missense probably benign 0.38
R5580:Por UTSW 5 135733821 missense probably damaging 0.98
R5895:Por UTSW 5 135715984 missense probably benign 0.03
R7225:Por UTSW 5 135732587 missense probably benign
R7422:Por UTSW 5 135734919 missense probably benign 0.06
R7461:Por UTSW 5 135729504 missense probably damaging 0.99
R7488:Por UTSW 5 135733644 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTCTCAGGGCCCATAGAG -3'
(R):5'- AACTGCTCCCTCCATGTGATG -3'

Sequencing Primer
(F):5'- TAGAGCCAGAGACTTCCAGTGC -3'
(R):5'- GTGATGAAATCCTCTTCCAAGCTGG -3'
Posted On2016-06-06