Incidental Mutation 'R5057:Sipa1l3'
ID390926
Institutional Source Beutler Lab
Gene Symbol Sipa1l3
Ensembl Gene ENSMUSG00000030583
Gene Namesignal-induced proliferation-associated 1 like 3
Synonyms2610511M17Rik
MMRRC Submission 042647-MU
Accession Numbers

NCBI RefSeq: NM_001081028.1; MGI: 1921456

Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R5057 (G1)
Quality Score205
Status Validated
Chromosome7
Chromosomal Location29320372-29518641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29371193 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 966 (N966S)
Ref Sequence ENSEMBL: ENSMUSP00000138171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085809] [ENSMUST00000182484] [ENSMUST00000183096] [ENSMUST00000183275]
Predicted Effect probably damaging
Transcript: ENSMUST00000085809
AA Change: N966S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082965
Gene: ENSMUSG00000030583
AA Change: N966S

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 816 1.7e-68 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:SPAR_C 1471 1721 1.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182484
SMART Domains Protein: ENSMUSP00000138714
Gene: ENSMUSG00000030583

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
Pfam:DUF3401 422 671 2.7e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182911
Predicted Effect probably damaging
Transcript: ENSMUST00000183096
AA Change: N966S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138171
Gene: ENSMUSG00000030583
AA Change: N966S

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 822 6.7e-64 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:DUF3401 1471 1721 7.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183275
Predicted Effect unknown
Transcript: ENSMUST00000183330
AA Change: N52S
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the signal induced proliferation associated 1 family of genes, which encode GTPase-activating proteins specific for the GTP-binding protein Rap1. Rap1 has been implicated in regulation of cell adhesion, cell polarity, and organization of the cytoskeleton. Like other members of the family, the protein encoded by this gene contains RapGAP and PDZ domains. In addition, this protein contains a C-terminal leucine zipper domain. This gene is proposed to function in epithelial cell morphogenesis and establishment or maintenance of polarity. Consistently, expression of the protein in cell culture showed localization to cell-cell borders in apical regions, and downregulation of the gene in 3D Caco2 cell culture resulted in abnormal cell polarity and morphogenesis. Allelic variants of this gene have been associated with congenital cataracts in humans. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small lenses, microphthalmia, cataracts, posterior iris synechia, and abnormal lens fiber morphology. [provided by MGI curators]
Allele List at MGI

All alleles(486) : Gene trapped(486)

Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,225,421 F207I probably benign Het
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Acad12 T A 5: 121,610,089 T89S probably benign Het
Adgb A G 10: 10,357,978 C1252R probably benign Het
Ankef1 A G 2: 136,550,360 probably null Het
Ankfy1 T C 11: 72,759,919 L976P probably damaging Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
Ankrd61 T A 5: 143,894,795 T64S probably benign Het
Anxa6 T G 11: 55,001,236 E298A possibly damaging Het
Apc2 A G 10: 80,309,069 S605G probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Bptf A T 11: 107,082,528 F693L probably damaging Het
Cacng4 A G 11: 107,794,371 Y32H probably damaging Het
Ccdc50 T A 16: 27,438,342 D252E probably benign Het
Ccdc92b C A 11: 74,638,150 T160K probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh22 C A 2: 165,116,143 V635F probably damaging Het
Cenpe G T 3: 135,220,313 A243S probably benign Het
Cep295 A T 9: 15,322,683 H2272Q probably benign Het
Cgnl1 A T 9: 71,724,794 V425D probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Cntnap5a C T 1: 115,685,213 T26I probably benign Het
Col6a3 T C 1: 90,816,130 K165R possibly damaging Het
Copb1 A T 7: 114,226,762 N662K probably benign Het
Crybg1 T A 10: 43,989,108 R1458* probably null Het
Cspp1 T A 1: 10,074,961 probably benign Het
Dhtkd1 A G 2: 5,919,513 C430R probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Ephb3 A G 16: 21,220,447 D351G probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fam161a T A 11: 23,020,397 C192S probably damaging Het
Fbn1 A G 2: 125,466,695 V149A probably benign Het
Fbxw16 A G 9: 109,441,164 S170P probably damaging Het
Fndc1 T A 17: 7,771,970 R965* probably null Het
Frem2 T C 3: 53,535,196 D2640G probably benign Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm44501 A G 17: 40,578,672 T26A probably benign Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5045 A T 15: 59,211,155 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpsm1 G A 2: 26,325,357 R277Q probably damaging Het
Inmt T A 6: 55,174,898 H29L probably benign Het
Insrr T A 3: 87,815,265 C1265S probably benign Het
Kctd12 A G 14: 102,981,609 F278L possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lag3 T A 6: 124,905,355 I393F possibly damaging Het
Lama2 C T 10: 27,164,986 C1447Y probably damaging Het
Lama3 G A 18: 12,531,948 G2275S probably null Het
Lrrc17 A T 5: 21,575,309 H427L probably benign Het
Med13l T A 5: 118,718,493 S164T probably damaging Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Myo5c A T 9: 75,300,873 T1630S probably damaging Het
Nbeal2 A T 9: 110,631,005 N1848K probably damaging Het
Ncor2 A T 5: 125,048,066 V307E possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Nipal3 T A 4: 135,466,856 I289F probably damaging Het
Nrg4 A G 9: 55,282,596 probably benign Het
Nrxn3 A T 12: 89,255,034 I528F probably damaging Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr748 A C 14: 50,711,212 N294T probably damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcnx2 T C 8: 125,855,191 I935M possibly damaging Het
Pik3c2a G T 7: 116,376,283 T683K possibly damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkd1l2 G A 8: 117,055,008 T766I probably benign Het
Polr3c C A 3: 96,712,057 L508F probably damaging Het
Por A G 5: 135,730,902 D189G probably damaging Het
Prim2 A T 1: 33,630,360 L178* probably null Het
Prima1 C A 12: 103,202,605 probably null Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rbm12 A T 2: 156,096,886 C489S probably benign Het
Rpl10a A T 17: 28,330,633 H140L probably benign Het
Rtbdn T C 8: 84,955,009 F143S probably damaging Het
Scamp3 T A 3: 89,182,293 probably benign Het
Setd5 A G 6: 113,137,961 S848G probably damaging Het
Sez6 T C 11: 77,973,153 V487A probably damaging Het
Shc2 G A 10: 79,623,872 P413S probably benign Het
Slc39a8 A G 3: 135,849,029 E78G probably benign Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Spire2 G A 8: 123,358,201 R260H probably damaging Het
Stk39 T A 2: 68,220,948 I518F probably damaging Het
Tardbp T A 4: 148,619,356 probably null Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Tll2 A G 19: 41,117,266 V358A probably benign Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tnfsf9 A G 17: 57,105,444 T5A probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim5 A G 7: 104,265,423 Y480H probably damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttn T A 2: 76,747,035 K22759* probably null Het
Ttn C A 2: 76,918,644 L4020F probably benign Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Ube3b T C 5: 114,406,257 F572L probably benign Het
Ubr5 A G 15: 38,004,109 V1332A probably damaging Het
Ubtd2 C A 11: 32,516,320 R180S probably damaging Het
Ubtf A G 11: 102,307,087 S673P probably damaging Het
Ubtfl1 A T 9: 18,409,191 D5V possibly damaging Het
Usp17la G A 7: 104,861,123 V312I possibly damaging Het
Usp17ld G T 7: 103,250,448 H426N probably benign Het
Usp34 A G 11: 23,458,086 probably benign Het
Vmn1r199 A T 13: 22,383,405 T290S possibly damaging Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vmn2r6 T A 3: 64,537,786 K839N probably damaging Het
Vmn2r65 A G 7: 84,940,611 I699T probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Wdr60 A T 12: 116,213,413 N856K probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Sipa1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Sipa1l3 APN 7 29354133 missense probably damaging 0.97
IGL00481:Sipa1l3 APN 7 29386108 missense probably damaging 0.99
IGL01071:Sipa1l3 APN 7 29324220 missense possibly damaging 0.88
IGL01300:Sipa1l3 APN 7 29399828 nonsense probably null
IGL01361:Sipa1l3 APN 7 29348687 missense probably damaging 1.00
IGL01380:Sipa1l3 APN 7 29331372 missense possibly damaging 0.94
IGL02083:Sipa1l3 APN 7 29387261 missense probably damaging 1.00
IGL02484:Sipa1l3 APN 7 29399531 missense probably damaging 1.00
IGL02542:Sipa1l3 APN 7 29388065 missense probably damaging 1.00
IGL02645:Sipa1l3 APN 7 29328980 splice site probably null
IGL03410:Sipa1l3 APN 7 29348539 missense probably damaging 1.00
P0014:Sipa1l3 UTSW 7 29383215 missense probably damaging 1.00
R0111:Sipa1l3 UTSW 7 29348318 missense probably damaging 0.99
R0309:Sipa1l3 UTSW 7 29348350 missense probably benign 0.01
R0554:Sipa1l3 UTSW 7 29388030 missense possibly damaging 0.90
R0624:Sipa1l3 UTSW 7 29387251 missense probably damaging 1.00
R0894:Sipa1l3 UTSW 7 29387291 nonsense probably null
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1550:Sipa1l3 UTSW 7 29383203 missense probably benign 0.00
R1850:Sipa1l3 UTSW 7 29339126 missense probably damaging 0.96
R1905:Sipa1l3 UTSW 7 29339167 missense possibly damaging 0.89
R1907:Sipa1l3 UTSW 7 29339167 missense possibly damaging 0.89
R1994:Sipa1l3 UTSW 7 29399611 missense probably benign 0.39
R2228:Sipa1l3 UTSW 7 29377939 nonsense probably null
R2267:Sipa1l3 UTSW 7 29399602 missense probably damaging 1.00
R2341:Sipa1l3 UTSW 7 29377635 missense probably damaging 0.98
R3914:Sipa1l3 UTSW 7 29400085 missense probably benign 0.28
R4197:Sipa1l3 UTSW 7 29400813 missense possibly damaging 0.81
R4559:Sipa1l3 UTSW 7 29332253 missense probably damaging 1.00
R4569:Sipa1l3 UTSW 7 29325862 missense probably damaging 1.00
R4783:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4784:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4785:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4823:Sipa1l3 UTSW 7 29371002 missense probably damaging 1.00
R5084:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5085:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5086:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5918:Sipa1l3 UTSW 7 29397206 missense probably damaging 1.00
R5973:Sipa1l3 UTSW 7 29399524 missense probably benign 0.20
R6291:Sipa1l3 UTSW 7 29388133 missense probably damaging 1.00
R6299:Sipa1l3 UTSW 7 29366549 critical splice donor site probably null
R6828:Sipa1l3 UTSW 7 29339032 missense probably benign 0.17
R6914:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R6942:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R7102:Sipa1l3 UTSW 7 29348587 missense possibly damaging 0.74
R7225:Sipa1l3 UTSW 7 29399428 missense probably damaging 1.00
R7310:Sipa1l3 UTSW 7 29399696 missense probably benign
R7429:Sipa1l3 UTSW 7 29387206 missense probably benign 0.24
R7489:Sipa1l3 UTSW 7 29366702 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCTTACCTTCGGGGAGTG -3'
(R):5'- ATCCTGATGGCACCTGGAAG -3'

Sequencing Primer
(F):5'- GGATGATGACCACCTTCACAGTG -3'
(R):5'- TGGCACCTGGAAGGCGAG -3'
Posted On2016-06-06