Incidental Mutation 'R5057:Ptpn23'
ID390946
Institutional Source Beutler Lab
Gene Symbol Ptpn23
Ensembl Gene ENSMUSG00000036057
Gene Nameprotein tyrosine phosphatase, non-receptor type 23
SynonymsPTP-TD14
MMRRC Submission 042647-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5057 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110385082-110408213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110388556 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 744 (T744I)
Ref Sequence ENSEMBL: ENSMUSP00000039580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040021] [ENSMUST00000098350]
PDB Structure
MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040021
AA Change: T744I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057
AA Change: T744I

DomainStartEndE-ValueType
BRO1 8 384 5.94e-159 SMART
Pfam:ALIX_LYPXL_bnd 416 704 1.4e-64 PFAM
low complexity region 715 728 N/A INTRINSIC
low complexity region 774 785 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 905 928 N/A INTRINSIC
internal_repeat_1 929 942 8.2e-5 PROSPERO
internal_repeat_1 943 956 8.2e-5 PROSPERO
low complexity region 977 1018 N/A INTRINSIC
low complexity region 1040 1061 N/A INTRINSIC
low complexity region 1088 1106 N/A INTRINSIC
low complexity region 1128 1160 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
low complexity region 1225 1235 N/A INTRINSIC
PTPc 1246 1510 1.28e-92 SMART
low complexity region 1576 1587 N/A INTRINSIC
low complexity region 1589 1643 N/A INTRINSIC
Blast:PTPc 1644 1673 9e-8 BLAST
low complexity region 1675 1689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098350
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200278
Predicted Effect probably benign
Transcript: ENSMUST00000200531
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Embryos homozygous for a gene trap allele are significantly growth retarded and fail to reach the E8.5 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,225,421 F207I probably benign Het
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Acad12 T A 5: 121,610,089 T89S probably benign Het
Adgb A G 10: 10,357,978 C1252R probably benign Het
Ankef1 A G 2: 136,550,360 probably null Het
Ankfy1 T C 11: 72,759,919 L976P probably damaging Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
Ankrd61 T A 5: 143,894,795 T64S probably benign Het
Anxa6 T G 11: 55,001,236 E298A possibly damaging Het
Apc2 A G 10: 80,309,069 S605G probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Bptf A T 11: 107,082,528 F693L probably damaging Het
Cacng4 A G 11: 107,794,371 Y32H probably damaging Het
Ccdc50 T A 16: 27,438,342 D252E probably benign Het
Ccdc92b C A 11: 74,638,150 T160K probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh22 C A 2: 165,116,143 V635F probably damaging Het
Cenpe G T 3: 135,220,313 A243S probably benign Het
Cep295 A T 9: 15,322,683 H2272Q probably benign Het
Cgnl1 A T 9: 71,724,794 V425D probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Cntnap5a C T 1: 115,685,213 T26I probably benign Het
Col6a3 T C 1: 90,816,130 K165R possibly damaging Het
Copb1 A T 7: 114,226,762 N662K probably benign Het
Crybg1 T A 10: 43,989,108 R1458* probably null Het
Cspp1 T A 1: 10,074,961 probably benign Het
Dhtkd1 A G 2: 5,919,513 C430R probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Ephb3 A G 16: 21,220,447 D351G probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fam161a T A 11: 23,020,397 C192S probably damaging Het
Fbn1 A G 2: 125,466,695 V149A probably benign Het
Fbxw16 A G 9: 109,441,164 S170P probably damaging Het
Fndc1 T A 17: 7,771,970 R965* probably null Het
Frem2 T C 3: 53,535,196 D2640G probably benign Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm44501 A G 17: 40,578,672 T26A probably benign Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5045 A T 15: 59,211,155 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpsm1 G A 2: 26,325,357 R277Q probably damaging Het
Inmt T A 6: 55,174,898 H29L probably benign Het
Insrr T A 3: 87,815,265 C1265S probably benign Het
Kctd12 A G 14: 102,981,609 F278L possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lag3 T A 6: 124,905,355 I393F possibly damaging Het
Lama2 C T 10: 27,164,986 C1447Y probably damaging Het
Lama3 G A 18: 12,531,948 G2275S probably null Het
Lrrc17 A T 5: 21,575,309 H427L probably benign Het
Med13l T A 5: 118,718,493 S164T probably damaging Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Myo5c A T 9: 75,300,873 T1630S probably damaging Het
Nbeal2 A T 9: 110,631,005 N1848K probably damaging Het
Ncor2 A T 5: 125,048,066 V307E possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Nipal3 T A 4: 135,466,856 I289F probably damaging Het
Nrg4 A G 9: 55,282,596 probably benign Het
Nrxn3 A T 12: 89,255,034 I528F probably damaging Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr748 A C 14: 50,711,212 N294T probably damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcnx2 T C 8: 125,855,191 I935M possibly damaging Het
Pik3c2a G T 7: 116,376,283 T683K possibly damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkd1l2 G A 8: 117,055,008 T766I probably benign Het
Polr3c C A 3: 96,712,057 L508F probably damaging Het
Por A G 5: 135,730,902 D189G probably damaging Het
Prim2 A T 1: 33,630,360 L178* probably null Het
Prima1 C A 12: 103,202,605 probably null Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rbm12 A T 2: 156,096,886 C489S probably benign Het
Rpl10a A T 17: 28,330,633 H140L probably benign Het
Rtbdn T C 8: 84,955,009 F143S probably damaging Het
Scamp3 T A 3: 89,182,293 probably benign Het
Setd5 A G 6: 113,137,961 S848G probably damaging Het
Sez6 T C 11: 77,973,153 V487A probably damaging Het
Shc2 G A 10: 79,623,872 P413S probably benign Het
Sipa1l3 T C 7: 29,371,193 N966S probably damaging Het
Slc39a8 A G 3: 135,849,029 E78G probably benign Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Spire2 G A 8: 123,358,201 R260H probably damaging Het
Stk39 T A 2: 68,220,948 I518F probably damaging Het
Tardbp T A 4: 148,619,356 probably null Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Tll2 A G 19: 41,117,266 V358A probably benign Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tnfsf9 A G 17: 57,105,444 T5A probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim5 A G 7: 104,265,423 Y480H probably damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttn T A 2: 76,747,035 K22759* probably null Het
Ttn C A 2: 76,918,644 L4020F probably benign Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Ube3b T C 5: 114,406,257 F572L probably benign Het
Ubr5 A G 15: 38,004,109 V1332A probably damaging Het
Ubtd2 C A 11: 32,516,320 R180S probably damaging Het
Ubtf A G 11: 102,307,087 S673P probably damaging Het
Ubtfl1 A T 9: 18,409,191 D5V possibly damaging Het
Usp17la G A 7: 104,861,123 V312I possibly damaging Het
Usp17ld G T 7: 103,250,448 H426N probably benign Het
Usp34 A G 11: 23,458,086 probably benign Het
Vmn1r199 A T 13: 22,383,405 T290S possibly damaging Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vmn2r6 T A 3: 64,537,786 K839N probably damaging Het
Vmn2r65 A G 7: 84,940,611 I699T probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Wdr60 A T 12: 116,213,413 N856K probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Ptpn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Ptpn23 APN 9 110388106 missense probably benign 0.00
IGL01462:Ptpn23 APN 9 110408107 missense probably benign 0.33
IGL01666:Ptpn23 APN 9 110386545 missense possibly damaging 0.95
IGL01757:Ptpn23 APN 9 110391636 missense probably damaging 1.00
IGL02402:Ptpn23 APN 9 110393713 missense possibly damaging 0.81
IGL02891:Ptpn23 APN 9 110388020 nonsense probably null
peony UTSW 9 110386507 missense probably damaging 0.97
FR4449:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4548:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4737:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4976:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
R0111:Ptpn23 UTSW 9 110385623 missense probably damaging 0.97
R0377:Ptpn23 UTSW 9 110388132 missense possibly damaging 0.73
R0432:Ptpn23 UTSW 9 110389010 critical splice donor site probably null
R0456:Ptpn23 UTSW 9 110389793 splice site probably null
R0457:Ptpn23 UTSW 9 110386293 missense possibly damaging 0.95
R0988:Ptpn23 UTSW 9 110388777 missense probably benign 0.02
R1072:Ptpn23 UTSW 9 110386595 missense probably benign 0.29
R1769:Ptpn23 UTSW 9 110391678 missense possibly damaging 0.89
R1859:Ptpn23 UTSW 9 110388870 missense possibly damaging 0.92
R1891:Ptpn23 UTSW 9 110393800 missense possibly damaging 0.74
R1915:Ptpn23 UTSW 9 110386507 missense probably damaging 0.97
R1954:Ptpn23 UTSW 9 110386325 missense probably damaging 0.99
R2299:Ptpn23 UTSW 9 110392513 missense possibly damaging 0.72
R2431:Ptpn23 UTSW 9 110386279 nonsense probably null
R2445:Ptpn23 UTSW 9 110387632 missense possibly damaging 0.79
R3014:Ptpn23 UTSW 9 110389695 missense probably benign
R3820:Ptpn23 UTSW 9 110389794 unclassified probably benign
R3904:Ptpn23 UTSW 9 110389245 missense probably benign 0.11
R4441:Ptpn23 UTSW 9 110392725 missense probably benign 0.01
R4464:Ptpn23 UTSW 9 110386813 missense probably damaging 1.00
R4709:Ptpn23 UTSW 9 110388856 missense possibly damaging 0.86
R4810:Ptpn23 UTSW 9 110389136 missense possibly damaging 0.93
R4937:Ptpn23 UTSW 9 110392738 missense probably benign 0.09
R5023:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5065:Ptpn23 UTSW 9 110398188 missense possibly damaging 0.91
R5143:Ptpn23 UTSW 9 110385438 unclassified probably benign
R5370:Ptpn23 UTSW 9 110385701 missense possibly damaging 0.79
R5534:Ptpn23 UTSW 9 110392741 missense possibly damaging 0.95
R5715:Ptpn23 UTSW 9 110387075 missense probably damaging 1.00
R5914:Ptpn23 UTSW 9 110385443 unclassified probably benign
R6122:Ptpn23 UTSW 9 110387825 unclassified probably benign
R6155:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6156:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6296:Ptpn23 UTSW 9 110393826 missense probably damaging 0.96
R6755:Ptpn23 UTSW 9 110389787 missense probably damaging 0.98
R7018:Ptpn23 UTSW 9 110385816 missense possibly damaging 0.89
R7126:Ptpn23 UTSW 9 110388744 missense probably benign 0.00
R7181:Ptpn23 UTSW 9 110385257 missense unknown
X0062:Ptpn23 UTSW 9 110387707 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTGAATAAGTTCCAGGGG -3'
(R):5'- ACAATCCATCTGTCGTGCC -3'

Sequencing Primer
(F):5'- AGTTCCAGGGGGTAAGGGTCC -3'
(R):5'- ATCCATCTGTCGTGCCCAAGAG -3'
Posted On2016-06-06