Incidental Mutation 'R5057:Nrxn3'
ID390971
Institutional Source Beutler Lab
Gene Symbol Nrxn3
Ensembl Gene ENSMUSG00000066392
Gene Nameneurexin III
Synonyms4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta
MMRRC Submission 042647-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5057 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location88722876-90334935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89255034 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 528 (I528F)
Ref Sequence ENSEMBL: ENSMUSP00000129678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057634
AA Change: I155F

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392
AA Change: I155F

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163134
AA Change: I528F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: I528F

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 843 4.87e-26 SMART
LamG 891 1027 7.08e-37 SMART
EGF 1052 1086 1.99e1 SMART
LamG 1114 1271 1.14e-17 SMART
low complexity region 1312 1328 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1499 1514 N/A INTRINSIC
4.1m 1517 1535 4.38e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167103
AA Change: I528F

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392
AA Change: I528F

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 834 5.76e-28 SMART
LamG 882 1018 7.08e-37 SMART
EGF 1043 1077 1.99e1 SMART
LamG 1105 1262 1.14e-17 SMART
low complexity region 1303 1319 N/A INTRINSIC
low complexity region 1354 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167734
Predicted Effect possibly damaging
Transcript: ENSMUST00000167887
AA Change: I155F

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392
AA Change: I155F

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190626
AA Change: I155F

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392
AA Change: I155F

DomainStartEndE-ValueType
LamG 94 246 2.1e-43 SMART
EGF 273 307 2e-4 SMART
LamG 332 470 3.1e-28 SMART
LamG 518 654 4.4e-39 SMART
EGF 688 722 9.6e-2 SMART
LamG 750 877 1.1e-22 SMART
low complexity region 918 934 N/A INTRINSIC
low complexity region 972 1000 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194420
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,225,421 F207I probably benign Het
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Acad12 T A 5: 121,610,089 T89S probably benign Het
Adgb A G 10: 10,357,978 C1252R probably benign Het
Ankef1 A G 2: 136,550,360 probably null Het
Ankfy1 T C 11: 72,759,919 L976P probably damaging Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
Ankrd61 T A 5: 143,894,795 T64S probably benign Het
Anxa6 T G 11: 55,001,236 E298A possibly damaging Het
Apc2 A G 10: 80,309,069 S605G probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Bptf A T 11: 107,082,528 F693L probably damaging Het
Cacng4 A G 11: 107,794,371 Y32H probably damaging Het
Ccdc50 T A 16: 27,438,342 D252E probably benign Het
Ccdc92b C A 11: 74,638,150 T160K probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh22 C A 2: 165,116,143 V635F probably damaging Het
Cenpe G T 3: 135,220,313 A243S probably benign Het
Cep295 A T 9: 15,322,683 H2272Q probably benign Het
Cgnl1 A T 9: 71,724,794 V425D probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Cntnap5a C T 1: 115,685,213 T26I probably benign Het
Col6a3 T C 1: 90,816,130 K165R possibly damaging Het
Copb1 A T 7: 114,226,762 N662K probably benign Het
Crybg1 T A 10: 43,989,108 R1458* probably null Het
Cspp1 T A 1: 10,074,961 probably benign Het
Dhtkd1 A G 2: 5,919,513 C430R probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Ephb3 A G 16: 21,220,447 D351G probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fam161a T A 11: 23,020,397 C192S probably damaging Het
Fbn1 A G 2: 125,466,695 V149A probably benign Het
Fbxw16 A G 9: 109,441,164 S170P probably damaging Het
Fndc1 T A 17: 7,771,970 R965* probably null Het
Frem2 T C 3: 53,535,196 D2640G probably benign Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm44501 A G 17: 40,578,672 T26A probably benign Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5045 A T 15: 59,211,155 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpsm1 G A 2: 26,325,357 R277Q probably damaging Het
Inmt T A 6: 55,174,898 H29L probably benign Het
Insrr T A 3: 87,815,265 C1265S probably benign Het
Kctd12 A G 14: 102,981,609 F278L possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lag3 T A 6: 124,905,355 I393F possibly damaging Het
Lama2 C T 10: 27,164,986 C1447Y probably damaging Het
Lama3 G A 18: 12,531,948 G2275S probably null Het
Lrrc17 A T 5: 21,575,309 H427L probably benign Het
Med13l T A 5: 118,718,493 S164T probably damaging Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Myo5c A T 9: 75,300,873 T1630S probably damaging Het
Nbeal2 A T 9: 110,631,005 N1848K probably damaging Het
Ncor2 A T 5: 125,048,066 V307E possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Nipal3 T A 4: 135,466,856 I289F probably damaging Het
Nrg4 A G 9: 55,282,596 probably benign Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr748 A C 14: 50,711,212 N294T probably damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcnx2 T C 8: 125,855,191 I935M possibly damaging Het
Pik3c2a G T 7: 116,376,283 T683K possibly damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkd1l2 G A 8: 117,055,008 T766I probably benign Het
Polr3c C A 3: 96,712,057 L508F probably damaging Het
Por A G 5: 135,730,902 D189G probably damaging Het
Prim2 A T 1: 33,630,360 L178* probably null Het
Prima1 C A 12: 103,202,605 probably null Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rbm12 A T 2: 156,096,886 C489S probably benign Het
Rpl10a A T 17: 28,330,633 H140L probably benign Het
Rtbdn T C 8: 84,955,009 F143S probably damaging Het
Scamp3 T A 3: 89,182,293 probably benign Het
Setd5 A G 6: 113,137,961 S848G probably damaging Het
Sez6 T C 11: 77,973,153 V487A probably damaging Het
Shc2 G A 10: 79,623,872 P413S probably benign Het
Sipa1l3 T C 7: 29,371,193 N966S probably damaging Het
Slc39a8 A G 3: 135,849,029 E78G probably benign Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Spire2 G A 8: 123,358,201 R260H probably damaging Het
Stk39 T A 2: 68,220,948 I518F probably damaging Het
Tardbp T A 4: 148,619,356 probably null Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Tll2 A G 19: 41,117,266 V358A probably benign Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tnfsf9 A G 17: 57,105,444 T5A probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim5 A G 7: 104,265,423 Y480H probably damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttn T A 2: 76,747,035 K22759* probably null Het
Ttn C A 2: 76,918,644 L4020F probably benign Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Ube3b T C 5: 114,406,257 F572L probably benign Het
Ubr5 A G 15: 38,004,109 V1332A probably damaging Het
Ubtd2 C A 11: 32,516,320 R180S probably damaging Het
Ubtf A G 11: 102,307,087 S673P probably damaging Het
Ubtfl1 A T 9: 18,409,191 D5V possibly damaging Het
Usp17la G A 7: 104,861,123 V312I possibly damaging Het
Usp17ld G T 7: 103,250,448 H426N probably benign Het
Usp34 A G 11: 23,458,086 probably benign Het
Vmn1r199 A T 13: 22,383,405 T290S possibly damaging Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vmn2r6 T A 3: 64,537,786 K839N probably damaging Het
Vmn2r65 A G 7: 84,940,611 I699T probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Wdr60 A T 12: 116,213,413 N856K probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Nrxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrxn3 APN 12 90204592 missense probably damaging 1.00
IGL00961:Nrxn3 APN 12 90204546 missense possibly damaging 0.95
IGL01073:Nrxn3 APN 12 89254740 missense probably benign 0.25
IGL01338:Nrxn3 APN 12 89255034 missense possibly damaging 0.86
IGL01377:Nrxn3 APN 12 89533012 critical splice donor site probably null
IGL01409:Nrxn3 APN 12 89510358 missense probably damaging 1.00
IGL01764:Nrxn3 APN 12 90204750 missense possibly damaging 0.48
IGL02063:Nrxn3 APN 12 88795795 missense possibly damaging 0.86
IGL02171:Nrxn3 APN 12 89193163 missense probably damaging 1.00
IGL02309:Nrxn3 APN 12 89976407 missense probably damaging 0.99
IGL02340:Nrxn3 APN 12 90204628 missense possibly damaging 0.82
IGL02343:Nrxn3 APN 12 88795353 missense probably damaging 1.00
IGL02600:Nrxn3 APN 12 89511912 splice site probably benign
IGL02735:Nrxn3 APN 12 89254854 missense probably benign 0.16
IGL03061:Nrxn3 APN 12 89511928 nonsense probably null
IGL03206:Nrxn3 APN 12 89260508 missense possibly damaging 0.88
IGL03337:Nrxn3 APN 12 89255020 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0144:Nrxn3 UTSW 12 89348392 missense probably damaging 1.00
R0334:Nrxn3 UTSW 12 89813642 critical splice donor site probably null
R0531:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R0840:Nrxn3 UTSW 12 90331793 missense possibly damaging 0.68
R1324:Nrxn3 UTSW 12 89254696 missense possibly damaging 0.89
R1438:Nrxn3 UTSW 12 90332135 missense probably damaging 1.00
R1484:Nrxn3 UTSW 12 89254777 missense probably damaging 0.99
R1621:Nrxn3 UTSW 12 88795710 missense probably benign
R1637:Nrxn3 UTSW 12 89354468 missense possibly damaging 0.94
R1659:Nrxn3 UTSW 12 90332391 missense probably damaging 1.00
R1746:Nrxn3 UTSW 12 89255019 missense possibly damaging 0.63
R1801:Nrxn3 UTSW 12 90283582 missense probably damaging 1.00
R1912:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R1940:Nrxn3 UTSW 12 89260381 missense probably damaging 0.98
R1993:Nrxn3 UTSW 12 89260411 missense possibly damaging 0.59
R2002:Nrxn3 UTSW 12 90332315 missense probably damaging 1.00
R2125:Nrxn3 UTSW 12 89260520 splice site probably null
R2179:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R2207:Nrxn3 UTSW 12 89348312 missense probably damaging 1.00
R2284:Nrxn3 UTSW 12 89510365 missense probably damaging 1.00
R2433:Nrxn3 UTSW 12 89976392 missense probably damaging 1.00
R2969:Nrxn3 UTSW 12 89354471 missense probably damaging 1.00
R3053:Nrxn3 UTSW 12 89255101 missense probably damaging 0.99
R3076:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R3078:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R4033:Nrxn3 UTSW 12 89533001 missense probably damaging 1.00
R4222:Nrxn3 UTSW 12 89532992 nonsense probably null
R4321:Nrxn3 UTSW 12 90199231 missense probably damaging 1.00
R4470:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4471:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4472:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4686:Nrxn3 UTSW 12 89510651 missense probably damaging 0.99
R4776:Nrxn3 UTSW 12 90331956 missense possibly damaging 0.55
R4821:Nrxn3 UTSW 12 90204709 missense probably damaging 0.99
R4869:Nrxn3 UTSW 12 88795582 missense possibly damaging 0.95
R4910:Nrxn3 UTSW 12 89260360 missense possibly damaging 0.72
R4960:Nrxn3 UTSW 12 88795201 missense possibly damaging 0.79
R4990:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R4991:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R5329:Nrxn3 UTSW 12 89813584 missense possibly damaging 0.92
R5888:Nrxn3 UTSW 12 89512085 missense possibly damaging 0.91
R6249:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R6264:Nrxn3 UTSW 12 90332237 missense probably damaging 1.00
R6373:Nrxn3 UTSW 12 89976469 missense probably damaging 1.00
R6401:Nrxn3 UTSW 12 89255000 missense possibly damaging 0.46
R6434:Nrxn3 UTSW 12 88795515 missense probably benign 0.32
R6528:Nrxn3 UTSW 12 89513049 missense probably damaging 1.00
R6612:Nrxn3 UTSW 12 89813332 intron probably benign
R6632:Nrxn3 UTSW 12 89193154 missense probably damaging 1.00
R6874:Nrxn3 UTSW 12 90332190 missense probably damaging 0.99
R7122:Nrxn3 UTSW 12 89510607 missense probably damaging 1.00
R7328:Nrxn3 UTSW 12 88795575 missense probably benign
R7352:Nrxn3 UTSW 12 88850293 missense probably benign
R7425:Nrxn3 UTSW 12 89513100 nonsense probably null
R7444:Nrxn3 UTSW 12 89510694 missense probably damaging 1.00
R7483:Nrxn3 UTSW 12 89510462 missense probably damaging 1.00
X0019:Nrxn3 UTSW 12 90199221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCAGCTTGCCCAAGTGG -3'
(R):5'- GTGAGCATGCAAGTTAGTGTCATC -3'

Sequencing Primer
(F):5'- ACCAAACGTATGGGCTCCATTTC -3'
(R):5'- TGGTCTCAATGCTAAGCC -3'
Posted On2016-06-06