Incidental Mutation 'R5057:Fndc1'
ID390985
Institutional Source Beutler Lab
Gene Symbol Fndc1
Ensembl Gene ENSMUSG00000071984
Gene Namefibronectin type III domain containing 1
Synonyms1110027O12Rik
MMRRC Submission 042647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5057 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location7738569-7827302 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 7771970 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 965 (R965*)
Ref Sequence ENSEMBL: ENSMUSP00000095036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097425]
Predicted Effect probably null
Transcript: ENSMUST00000097425
AA Change: R965*
SMART Domains Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984
AA Change: R965*

DomainStartEndE-ValueType
Blast:FN3 1 50 6e-25 BLAST
FN3 54 137 7.82e-4 SMART
FN3 156 240 1.48e-4 SMART
FN3 256 340 3.67e-9 SMART
low complexity region 377 388 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 646 676 N/A INTRINSIC
low complexity region 766 777 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 1021 1027 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
Blast:FN3 1227 1276 2e-18 BLAST
low complexity region 1277 1354 N/A INTRINSIC
low complexity region 1395 1403 N/A INTRINSIC
low complexity region 1407 1423 N/A INTRINSIC
FN3 1494 1577 4.32e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114579
Meta Mutation Damage Score 0.6064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 97% (118/122)
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,225,421 F207I probably benign Het
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Acad12 T A 5: 121,610,089 T89S probably benign Het
Adgb A G 10: 10,357,978 C1252R probably benign Het
Ankef1 A G 2: 136,550,360 probably null Het
Ankfy1 T C 11: 72,759,919 L976P probably damaging Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
Ankrd61 T A 5: 143,894,795 T64S probably benign Het
Anxa6 T G 11: 55,001,236 E298A possibly damaging Het
Apc2 A G 10: 80,309,069 S605G probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Bptf A T 11: 107,082,528 F693L probably damaging Het
Cacng4 A G 11: 107,794,371 Y32H probably damaging Het
Ccdc50 T A 16: 27,438,342 D252E probably benign Het
Ccdc92b C A 11: 74,638,150 T160K probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh22 C A 2: 165,116,143 V635F probably damaging Het
Cenpe G T 3: 135,220,313 A243S probably benign Het
Cep295 A T 9: 15,322,683 H2272Q probably benign Het
Cgnl1 A T 9: 71,724,794 V425D probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Cntnap5a C T 1: 115,685,213 T26I probably benign Het
Col6a3 T C 1: 90,816,130 K165R possibly damaging Het
Copb1 A T 7: 114,226,762 N662K probably benign Het
Crybg1 T A 10: 43,989,108 R1458* probably null Het
Cspp1 T A 1: 10,074,961 probably benign Het
Dhtkd1 A G 2: 5,919,513 C430R probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Ephb3 A G 16: 21,220,447 D351G probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fam161a T A 11: 23,020,397 C192S probably damaging Het
Fbn1 A G 2: 125,466,695 V149A probably benign Het
Fbxw16 A G 9: 109,441,164 S170P probably damaging Het
Frem2 T C 3: 53,535,196 D2640G probably benign Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm44501 A G 17: 40,578,672 T26A probably benign Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5045 A T 15: 59,211,155 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpsm1 G A 2: 26,325,357 R277Q probably damaging Het
Inmt T A 6: 55,174,898 H29L probably benign Het
Insrr T A 3: 87,815,265 C1265S probably benign Het
Kctd12 A G 14: 102,981,609 F278L possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lag3 T A 6: 124,905,355 I393F possibly damaging Het
Lama2 C T 10: 27,164,986 C1447Y probably damaging Het
Lama3 G A 18: 12,531,948 G2275S probably null Het
Lrrc17 A T 5: 21,575,309 H427L probably benign Het
Med13l T A 5: 118,718,493 S164T probably damaging Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Myo5c A T 9: 75,300,873 T1630S probably damaging Het
Nbeal2 A T 9: 110,631,005 N1848K probably damaging Het
Ncor2 A T 5: 125,048,066 V307E possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Nipal3 T A 4: 135,466,856 I289F probably damaging Het
Nrg4 A G 9: 55,282,596 probably benign Het
Nrxn3 A T 12: 89,255,034 I528F probably damaging Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr748 A C 14: 50,711,212 N294T probably damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcnx2 T C 8: 125,855,191 I935M possibly damaging Het
Pik3c2a G T 7: 116,376,283 T683K possibly damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkd1l2 G A 8: 117,055,008 T766I probably benign Het
Polr3c C A 3: 96,712,057 L508F probably damaging Het
Por A G 5: 135,730,902 D189G probably damaging Het
Prim2 A T 1: 33,630,360 L178* probably null Het
Prima1 C A 12: 103,202,605 probably null Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rbm12 A T 2: 156,096,886 C489S probably benign Het
Rpl10a A T 17: 28,330,633 H140L probably benign Het
Rtbdn T C 8: 84,955,009 F143S probably damaging Het
Scamp3 T A 3: 89,182,293 probably benign Het
Setd5 A G 6: 113,137,961 S848G probably damaging Het
Sez6 T C 11: 77,973,153 V487A probably damaging Het
Shc2 G A 10: 79,623,872 P413S probably benign Het
Sipa1l3 T C 7: 29,371,193 N966S probably damaging Het
Slc39a8 A G 3: 135,849,029 E78G probably benign Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Spire2 G A 8: 123,358,201 R260H probably damaging Het
Stk39 T A 2: 68,220,948 I518F probably damaging Het
Tardbp T A 4: 148,619,356 probably null Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Tll2 A G 19: 41,117,266 V358A probably benign Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tnfsf9 A G 17: 57,105,444 T5A probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim5 A G 7: 104,265,423 Y480H probably damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttn T A 2: 76,747,035 K22759* probably null Het
Ttn C A 2: 76,918,644 L4020F probably benign Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Ube3b T C 5: 114,406,257 F572L probably benign Het
Ubr5 A G 15: 38,004,109 V1332A probably damaging Het
Ubtd2 C A 11: 32,516,320 R180S probably damaging Het
Ubtf A G 11: 102,307,087 S673P probably damaging Het
Ubtfl1 A T 9: 18,409,191 D5V possibly damaging Het
Usp17la G A 7: 104,861,123 V312I possibly damaging Het
Usp17ld G T 7: 103,250,448 H426N probably benign Het
Usp34 A G 11: 23,458,086 probably benign Het
Vmn1r199 A T 13: 22,383,405 T290S possibly damaging Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vmn2r6 T A 3: 64,537,786 K839N probably damaging Het
Vmn2r65 A G 7: 84,940,611 I699T probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Wdr60 A T 12: 116,213,413 N856K probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Fndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Fndc1 APN 17 7765254 missense unknown
IGL00590:Fndc1 APN 17 7765101 missense unknown
IGL00765:Fndc1 APN 17 7772693 missense unknown
IGL00904:Fndc1 APN 17 7756363 missense probably benign 0.35
IGL01153:Fndc1 APN 17 7780042 critical splice donor site probably null
IGL01557:Fndc1 APN 17 7756389 missense probably damaging 0.99
IGL02493:Fndc1 APN 17 7775545 missense unknown
IGL02501:Fndc1 APN 17 7765398 missense unknown
IGL02503:Fndc1 APN 17 7771516 missense unknown
IGL02887:Fndc1 APN 17 7773638 missense unknown
IGL03348:Fndc1 APN 17 7772647 missense unknown
pinnacle UTSW 17 7773322 missense unknown
spire UTSW 17 7771480 missense unknown
IGL02988:Fndc1 UTSW 17 7753523 missense possibly damaging 0.95
PIT4466001:Fndc1 UTSW 17 7750374 missense probably damaging 1.00
R0336:Fndc1 UTSW 17 7765107 missense unknown
R0403:Fndc1 UTSW 17 7753723 missense probably damaging 1.00
R0403:Fndc1 UTSW 17 7775588 intron probably null
R0538:Fndc1 UTSW 17 7784341 splice site probably benign
R0646:Fndc1 UTSW 17 7741673 missense possibly damaging 0.92
R1140:Fndc1 UTSW 17 7775426 missense unknown
R1523:Fndc1 UTSW 17 7773209 missense unknown
R1609:Fndc1 UTSW 17 7772766 missense unknown
R1632:Fndc1 UTSW 17 7773200 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R2004:Fndc1 UTSW 17 7804929 missense probably damaging 1.00
R2007:Fndc1 UTSW 17 7778748 unclassified probably benign
R2128:Fndc1 UTSW 17 7778665 unclassified probably benign
R2187:Fndc1 UTSW 17 7741772 missense probably damaging 1.00
R2251:Fndc1 UTSW 17 7753607 missense probably damaging 1.00
R2322:Fndc1 UTSW 17 7789015 missense probably damaging 0.98
R2425:Fndc1 UTSW 17 7805018 missense probably damaging 1.00
R2921:Fndc1 UTSW 17 7804875 missense probably damaging 0.98
R2985:Fndc1 UTSW 17 7756323 missense possibly damaging 0.93
R3436:Fndc1 UTSW 17 7750357 missense probably damaging 0.99
R3499:Fndc1 UTSW 17 7753584 missense possibly damaging 0.70
R3508:Fndc1 UTSW 17 7765108 nonsense probably null
R3766:Fndc1 UTSW 17 7784421 missense probably damaging 1.00
R3813:Fndc1 UTSW 17 7773322 missense unknown
R3814:Fndc1 UTSW 17 7773322 missense unknown
R4031:Fndc1 UTSW 17 7769752 nonsense probably null
R4544:Fndc1 UTSW 17 7773544 missense unknown
R4583:Fndc1 UTSW 17 7739249 missense probably damaging 1.00
R4619:Fndc1 UTSW 17 7765204 missense unknown
R4700:Fndc1 UTSW 17 7771480 missense unknown
R4743:Fndc1 UTSW 17 7772279 nonsense probably null
R4803:Fndc1 UTSW 17 7753706 missense probably damaging 0.98
R4862:Fndc1 UTSW 17 7769735 missense unknown
R4876:Fndc1 UTSW 17 7771639 missense unknown
R5327:Fndc1 UTSW 17 7772708 missense unknown
R5372:Fndc1 UTSW 17 7765210 missense unknown
R5533:Fndc1 UTSW 17 7772776 missense unknown
R5754:Fndc1 UTSW 17 7769753 missense unknown
R5762:Fndc1 UTSW 17 7771534 missense unknown
R5830:Fndc1 UTSW 17 7789086 missense possibly damaging 0.87
R5924:Fndc1 UTSW 17 7773610 missense unknown
R6147:Fndc1 UTSW 17 7753762 splice site probably null
R6175:Fndc1 UTSW 17 7772647 missense unknown
R6303:Fndc1 UTSW 17 7758485 missense probably damaging 0.98
R6377:Fndc1 UTSW 17 7769735 missense unknown
R6704:Fndc1 UTSW 17 7771810 missense unknown
R6857:Fndc1 UTSW 17 7772170 missense unknown
R6865:Fndc1 UTSW 17 7772840 missense unknown
R7069:Fndc1 UTSW 17 7769735 missense unknown
R7153:Fndc1 UTSW 17 7801645 missense probably damaging 1.00
R7159:Fndc1 UTSW 17 7800931 missense probably damaging 0.97
Z1088:Fndc1 UTSW 17 7782479 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGTCAAGGTTCCTGTCTGC -3'
(R):5'- GGCTCCCCAGAATCAGAATG -3'

Sequencing Primer
(F):5'- GGCCACTTTTTAACTGAGGTAGACAG -3'
(R):5'- TCCCCAGAATCAGAATGAGGGTTC -3'
Posted On2016-06-06