Incidental Mutation 'R5057:Xiap'
ID390993
Institutional Source Beutler Lab
Gene Symbol Xiap
Ensembl Gene ENSMUSG00000025860
Gene NameX-linked inhibitor of apoptosis
SynonymsIAP3, 1110015C02Rik, Aipa, ILP-1, Birc4, Api3
MMRRC Submission 042647-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5057 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location42059679-42109656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42094465 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 23 (F23L)
Ref Sequence ENSEMBL: ENSMUSP00000153528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026978] [ENSMUST00000055483] [ENSMUST00000115094] [ENSMUST00000115095] [ENSMUST00000126375] [ENSMUST00000224454]
Predicted Effect probably benign
Transcript: ENSMUST00000026978
AA Change: F23L

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026978
Gene: ENSMUSG00000025860
AA Change: F23L

DomainStartEndE-ValueType
BIR 24 95 3.67e-31 SMART
BIR 161 232 7.44e-41 SMART
BIR 262 331 6.06e-32 SMART
PDB:2KNA|A 351 436 5e-41 PDB
low complexity region 437 446 N/A INTRINSIC
RING 449 483 4.05e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055483
AA Change: F23L

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061074
Gene: ENSMUSG00000025860
AA Change: F23L

DomainStartEndE-ValueType
BIR 24 95 3.67e-31 SMART
BIR 161 232 7.44e-41 SMART
BIR 262 331 6.06e-32 SMART
PDB:2KNA|A 351 436 5e-41 PDB
low complexity region 437 446 N/A INTRINSIC
RING 449 483 4.05e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115094
AA Change: F23L

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110746
Gene: ENSMUSG00000025860
AA Change: F23L

DomainStartEndE-ValueType
BIR 24 95 3.67e-31 SMART
BIR 161 232 7.44e-41 SMART
BIR 262 331 6.06e-32 SMART
PDB:2KNA|A 351 436 5e-41 PDB
low complexity region 437 446 N/A INTRINSIC
RING 449 483 4.05e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115095
AA Change: F23L

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110747
Gene: ENSMUSG00000025860
AA Change: F23L

DomainStartEndE-ValueType
BIR 24 95 3.67e-31 SMART
BIR 161 232 7.44e-41 SMART
BIR 262 331 6.06e-32 SMART
PDB:2KNA|A 351 436 5e-41 PDB
low complexity region 437 446 N/A INTRINSIC
RING 449 483 4.05e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126375
AA Change: F23L

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121482
Gene: ENSMUSG00000025860
AA Change: F23L

DomainStartEndE-ValueType
PDB:2POI|A 10 53 3e-20 PDB
SCOP:d1jd5a_ 22 52 8e-7 SMART
Blast:BIR 24 53 4e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150635
Predicted Effect probably benign
Transcript: ENSMUST00000224454
AA Change: F23L

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1104 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the inhibitor of apoptosis (IAP) family of proteins. While first identified for its role in blocking apoptosis, this protein modulates many other signaling processes including nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathways and inflammatory responses. This protein blocks apoptosis by binding and inhibiting target caspases after they have been activated. Binding occurs to some, but not all, caspases. This protein has several conserved regions, including baculoviral IAP repeat (BIR) motifs and a RING finger E3 ligase domain. In humans, mutations in this gene are linked to immunodeficiency in X-linked lymphoproliferative syndrome type-2 (XLP-2). A pseudogene of this gene is found on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mutants are indistinguishable from normal littermates, but increased levels of protein from other Birc gene family members suggest a compensatory mechanism in the absence of the Birc4 gene's product. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,225,421 F207I probably benign Het
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Acad12 T A 5: 121,610,089 T89S probably benign Het
Adgb A G 10: 10,357,978 C1252R probably benign Het
Ankef1 A G 2: 136,550,360 probably null Het
Ankfy1 T C 11: 72,759,919 L976P probably damaging Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
Ankrd61 T A 5: 143,894,795 T64S probably benign Het
Anxa6 T G 11: 55,001,236 E298A possibly damaging Het
Apc2 A G 10: 80,309,069 S605G probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Bptf A T 11: 107,082,528 F693L probably damaging Het
Cacng4 A G 11: 107,794,371 Y32H probably damaging Het
Ccdc50 T A 16: 27,438,342 D252E probably benign Het
Ccdc92b C A 11: 74,638,150 T160K probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh22 C A 2: 165,116,143 V635F probably damaging Het
Cenpe G T 3: 135,220,313 A243S probably benign Het
Cep295 A T 9: 15,322,683 H2272Q probably benign Het
Cgnl1 A T 9: 71,724,794 V425D probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Cntnap5a C T 1: 115,685,213 T26I probably benign Het
Col6a3 T C 1: 90,816,130 K165R possibly damaging Het
Copb1 A T 7: 114,226,762 N662K probably benign Het
Crybg1 T A 10: 43,989,108 R1458* probably null Het
Cspp1 T A 1: 10,074,961 probably benign Het
Dhtkd1 A G 2: 5,919,513 C430R probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Ephb3 A G 16: 21,220,447 D351G probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fam161a T A 11: 23,020,397 C192S probably damaging Het
Fbn1 A G 2: 125,466,695 V149A probably benign Het
Fbxw16 A G 9: 109,441,164 S170P probably damaging Het
Fndc1 T A 17: 7,771,970 R965* probably null Het
Frem2 T C 3: 53,535,196 D2640G probably benign Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm44501 A G 17: 40,578,672 T26A probably benign Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5045 A T 15: 59,211,155 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpsm1 G A 2: 26,325,357 R277Q probably damaging Het
Inmt T A 6: 55,174,898 H29L probably benign Het
Insrr T A 3: 87,815,265 C1265S probably benign Het
Kctd12 A G 14: 102,981,609 F278L possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lag3 T A 6: 124,905,355 I393F possibly damaging Het
Lama2 C T 10: 27,164,986 C1447Y probably damaging Het
Lama3 G A 18: 12,531,948 G2275S probably null Het
Lrrc17 A T 5: 21,575,309 H427L probably benign Het
Med13l T A 5: 118,718,493 S164T probably damaging Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Myo5c A T 9: 75,300,873 T1630S probably damaging Het
Nbeal2 A T 9: 110,631,005 N1848K probably damaging Het
Ncor2 A T 5: 125,048,066 V307E possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Nipal3 T A 4: 135,466,856 I289F probably damaging Het
Nrg4 A G 9: 55,282,596 probably benign Het
Nrxn3 A T 12: 89,255,034 I528F probably damaging Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr748 A C 14: 50,711,212 N294T probably damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcnx2 T C 8: 125,855,191 I935M possibly damaging Het
Pik3c2a G T 7: 116,376,283 T683K possibly damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkd1l2 G A 8: 117,055,008 T766I probably benign Het
Polr3c C A 3: 96,712,057 L508F probably damaging Het
Por A G 5: 135,730,902 D189G probably damaging Het
Prim2 A T 1: 33,630,360 L178* probably null Het
Prima1 C A 12: 103,202,605 probably null Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rbm12 A T 2: 156,096,886 C489S probably benign Het
Rpl10a A T 17: 28,330,633 H140L probably benign Het
Rtbdn T C 8: 84,955,009 F143S probably damaging Het
Scamp3 T A 3: 89,182,293 probably benign Het
Setd5 A G 6: 113,137,961 S848G probably damaging Het
Sez6 T C 11: 77,973,153 V487A probably damaging Het
Shc2 G A 10: 79,623,872 P413S probably benign Het
Sipa1l3 T C 7: 29,371,193 N966S probably damaging Het
Slc39a8 A G 3: 135,849,029 E78G probably benign Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Spire2 G A 8: 123,358,201 R260H probably damaging Het
Stk39 T A 2: 68,220,948 I518F probably damaging Het
Tardbp T A 4: 148,619,356 probably null Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Tll2 A G 19: 41,117,266 V358A probably benign Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tnfsf9 A G 17: 57,105,444 T5A probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim5 A G 7: 104,265,423 Y480H probably damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttn T A 2: 76,747,035 K22759* probably null Het
Ttn C A 2: 76,918,644 L4020F probably benign Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Ube3b T C 5: 114,406,257 F572L probably benign Het
Ubr5 A G 15: 38,004,109 V1332A probably damaging Het
Ubtd2 C A 11: 32,516,320 R180S probably damaging Het
Ubtf A G 11: 102,307,087 S673P probably damaging Het
Ubtfl1 A T 9: 18,409,191 D5V possibly damaging Het
Usp17la G A 7: 104,861,123 V312I possibly damaging Het
Usp17ld G T 7: 103,250,448 H426N probably benign Het
Usp34 A G 11: 23,458,086 probably benign Het
Vmn1r199 A T 13: 22,383,405 T290S possibly damaging Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vmn2r6 T A 3: 64,537,786 K839N probably damaging Het
Vmn2r65 A G 7: 84,940,611 I699T probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Wdr60 A T 12: 116,213,413 N856K probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Xiap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Xiap APN X 42094552 missense probably damaging 1.00
IGL02015:Xiap APN X 42096610 unclassified probably benign
IGL02093:Xiap APN X 42099827 splice site probably benign
R5022:Xiap UTSW X 42094465 missense probably benign 0.34
R5023:Xiap UTSW X 42094465 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GTTTGGTAATGTACGACTCTACTG -3'
(R):5'- AGCTGAGTCTCCATACTGCC -3'

Sequencing Primer
(F):5'- TGGTAATGTACGACTCTACTGTTTAG -3'
(R):5'- CATCTATCTATTGCCGCATGACAAC -3'
Posted On2016-06-06