Incidental Mutation 'R5058:Polr3c'
ID391002
Institutional Source Beutler Lab
Gene Symbol Polr3c
Ensembl Gene ENSMUSG00000028099
Gene Namepolymerase (RNA) III (DNA directed) polypeptide C
Synonyms4933407E01Rik, RPC62, RPC3
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5058 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96711490-96727628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96723517 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 196 (I196V)
Ref Sequence ENSEMBL: ENSMUSP00000122435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029740] [ENSMUST00000029741] [ENSMUST00000125183] [ENSMUST00000141377] [ENSMUST00000154679] [ENSMUST00000199051]
Predicted Effect probably benign
Transcript: ENSMUST00000029740
SMART Domains Protein: ENSMUSP00000029740
Gene: ENSMUSG00000028098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RING 229 269 1.14e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029741
AA Change: I196V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029741
Gene: ENSMUSG00000028099
AA Change: I196V

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 9.4e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083735
Predicted Effect probably benign
Transcript: ENSMUST00000125183
SMART Domains Protein: ENSMUSP00000123513
Gene: ENSMUSG00000028099

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 4.6e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000128918
AA Change: I69V
SMART Domains Protein: ENSMUSP00000119236
Gene: ENSMUSG00000028099
AA Change: I69V

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpc82 20 180 5.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137009
Predicted Effect probably benign
Transcript: ENSMUST00000141377
AA Change: I196V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115300
Gene: ENSMUSG00000028099
AA Change: I196V

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 3.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154679
AA Change: I196V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122435
Gene: ENSMUSG00000028099
AA Change: I196V

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 1.6e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197075
Predicted Effect probably benign
Transcript: ENSMUST00000199051
SMART Domains Protein: ENSMUSP00000143321
Gene: ENSMUSG00000028098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:zf-RING_3 18 49 4.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199974
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Polr3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Polr3c APN 3 96713520 missense probably damaging 1.00
IGL01904:Polr3c APN 3 96716665 critical splice donor site probably null
IGL01964:Polr3c APN 3 96711975 unclassified probably benign
IGL02640:Polr3c APN 3 96716686 missense probably damaging 0.98
IGL02955:Polr3c APN 3 96714312 missense probably damaging 1.00
IGL03129:Polr3c APN 3 96719454 splice site probably benign
IGL03263:Polr3c APN 3 96714251 splice site probably benign
R0503:Polr3c UTSW 3 96713636 splice site probably null
R0800:Polr3c UTSW 3 96719311 missense probably damaging 0.99
R0881:Polr3c UTSW 3 96723847 missense probably damaging 0.99
R1763:Polr3c UTSW 3 96713595 missense probably damaging 1.00
R1931:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1932:Polr3c UTSW 3 96719298 missense probably damaging 1.00
R1994:Polr3c UTSW 3 96714373 splice site probably null
R3771:Polr3c UTSW 3 96725854 missense probably damaging 1.00
R4116:Polr3c UTSW 3 96715244 missense probably damaging 1.00
R4614:Polr3c UTSW 3 96716471 missense probably benign 0.00
R4732:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R4733:Polr3c UTSW 3 96723661 missense probably damaging 1.00
R5057:Polr3c UTSW 3 96712057 missense probably damaging 0.98
R5756:Polr3c UTSW 3 96714134 missense probably damaging 1.00
R6005:Polr3c UTSW 3 96719468 missense possibly damaging 0.96
R6009:Polr3c UTSW 3 96713614 missense probably damaging 1.00
R6580:Polr3c UTSW 3 96727343 splice site probably null
R7003:Polr3c UTSW 3 96723638 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCACAAATCCAGTCCTTCC -3'
(R):5'- TGGCAAGACCATGGACTACG -3'

Sequencing Primer
(F):5'- CTGGAAATTGAACCTGGGTCCTC -3'
(R):5'- ACCATGGACTACGCTGAGGTATC -3'
Posted On2016-06-06